Mutagenetix > Incidental Mutation

Incidental Mutation 'R7276:Adamts18'

565587

Institutional Source

Beutler Lab

Gene Symbol

Adamts18

Ensembl Gene

ENSMUSG00000053399

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18

Synonyms

E130314N14Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R7276 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113697126-113848738 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113775264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 322 (M322L)

Ref Sequence

ENSEMBL: ENSMUSP00000090801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]

AlphaFold

Q4VC17

Predicted Effect

probably damaging
Transcript: ENSMUST00000093113
AA Change: M322L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: M322L

Domain	Start	End	E-Value	Type
signal peptide	1	47	N/A	INTRINSIC
Pfam:Pep_M12B_propep	63	203	3.4e-37	PFAM
Pfam:Reprolysin_5	292	473	1.3e-14	PFAM
Pfam:Reprolysin_4	294	494	2.6e-11	PFAM
Pfam:Reprolysin	294	498	2.7e-30	PFAM
Pfam:Reprolysin_2	311	488	1.7e-14	PFAM
Pfam:Reprolysin_3	315	447	1.5e-11	PFAM
TSP1	592	644	7.37e-17	SMART
Pfam:ADAM_spacer1	749	861	1.7e-38	PFAM
TSP1	878	932	1.55e-1	SMART
TSP1	934	992	5.07e-6	SMART
TSP1	994	1049	1.65e-5	SMART
TSP1	1055	1116	1.71e-3	SMART
TSP1	1125	1171	5.27e-4	SMART
Pfam:PLAC	1186	1216	1.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212437

Predicted Effect

probably benign
Transcript: ENSMUST00000212665

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930455H04Rik	T	C	3: 116,968,578	V26A	unknown	Het
4930546C10Rik	C	T	18: 68,950,022	W40*	probably null	Het
Abcc5	T	C	16: 20,376,508		probably null	Het
Ankrd44	T	A	1: 54,735,080	N406I	probably benign	Het
Arhgap35	T	G	7: 16,564,568	T191P	probably damaging	Het
Atg3	G	A	16: 45,162,442	E37K	possibly damaging	Het
Bbs1	A	T	19: 4,897,710		probably null	Het
BC048562	A	G	9: 108,445,236	N60D	probably damaging	Het
Btnl9	T	A	11: 49,175,790	I335F	probably benign	Het
C7	A	T	15: 5,011,967	C486S	probably damaging	Het
Cchcr1	C	A	17: 35,529,134	Q634K	possibly damaging	Het
Cd93	A	T	2: 148,441,740	V562E	probably damaging	Het
Cript	T	A	17: 87,034,268	Y50*	probably null	Het
Dnah14	T	A	1: 181,685,807	F1908L	probably benign	Het
Dnah5	A	G	15: 28,367,838	N2790D	probably damaging	Het
Eif3h	C	A	15: 51,865,321		probably null	Het
Ffar3	C	G	7: 30,855,848	V16L	possibly damaging	Het
Gcn1l1	C	T	5: 115,611,060	R1884W	probably damaging	Het
Gm13128	A	G	4: 144,332,646	E309G	possibly damaging	Het
Gpatch1	T	A	7: 35,297,496	M426L	probably benign	Het
Hcn2	T	A	10: 79,729,100	Y449N	possibly damaging	Het
Hdac10	T	C	15: 89,128,285	T32A	probably benign	Het
Hykk	T	C	9: 54,946,218	Y275H	probably damaging	Het
Igfn1	G	C	1: 135,998,638	P25A	possibly damaging	Het
Jph1	T	C	1: 17,092,042	Q132R	probably damaging	Het
Kat2b	T	A	17: 53,624,422	D149E	probably damaging	Het
Knl1	A	T	2: 119,071,686	K1289N	probably damaging	Het
Lrrc37a	G	A	11: 103,456,746	S3041L	unknown	Het
Mtus2	C	T	5: 148,076,558	R54C	probably benign	Het
Myo1d	A	T	11: 80,693,072	I38N	probably damaging	Het
Nasp	A	G	4: 116,614,349	S94P	probably damaging	Het
Nfat5	C	A	8: 107,367,099	N657K	probably benign	Het
Ngfr	A	G	11: 95,574,344	L226P	probably benign	Het
Nos1	T	C	5: 117,910,238	S703P	probably damaging	Het
Nsun7	A	G	5: 66,277,141	D275G	probably benign	Het
Oas1d	A	G	5: 120,916,881	N172S	possibly damaging	Het
Olfr1201	T	A	2: 88,794,681	F100I	probably damaging	Het
Olfr1390	T	A	11: 49,340,994	M154K	probably benign	Het
Olfr671	T	A	7: 104,975,650	M116L	possibly damaging	Het
Olfr749	A	G	14: 50,736,730	V144A	possibly damaging	Het
Papss1	A	G	3: 131,619,234	E484G	probably benign	Het
Pcdh15	A	G	10: 74,324,392	D447G	probably benign	Het
Phkg2	A	G	7: 127,582,386	E247G	possibly damaging	Het
Prelid2	T	C	18: 41,912,422	N141S	possibly damaging	Het
Psg18	T	C	7: 18,345,984	M431V	probably damaging	Het
Psmd12	A	T	11: 107,503,645	R397*	probably null	Het
Ralgds	G	A	2: 28,545,872	R503Q	probably damaging	Het
Rb1cc1	G	A	1: 6,249,192	C945Y	probably benign	Het
Rgs12	A	G	5: 35,026,371	D1026G	probably benign	Het
Scn7a	G	A	2: 66,757,162	P66S	probably damaging	Het
Skiv2l2	A	T	13: 112,914,439	Y201N	probably benign	Het
Supt16	T	C	14: 52,177,001	E448G	probably benign	Het
Syt16	C	T	12: 74,266,709	R470C	probably damaging	Het
Tas2r114	T	C	6: 131,689,347	I239M	probably damaging	Het
Tecpr1	C	T	5: 144,217,020	W138*	probably null	Het
Tex101	T	C	7: 24,670,404	N45S	probably damaging	Het
Tmem2	A	G	19: 21,835,460	I1010V	probably benign	Het
Tmx1	C	A	12: 70,466,143	T275K	possibly damaging	Het
Trappc8	T	G	18: 20,818,091	I1434L	probably damaging	Het
Trappc9	G	T	15: 73,052,270	H208N	probably damaging	Het
Trcg1	T	A	9: 57,242,579	L478Q	probably damaging	Het
Trim42	G	T	9: 97,369,572	Y91*	probably null	Het
Vmn2r114	A	G	17: 23,290,960	S849P	probably damaging	Het
Vmn2r120	T	C	17: 57,524,881	T303A	probably benign	Het
Vmn2r13	A	G	5: 109,173,779	W351R	probably damaging	Het
Vmn2r53	T	C	7: 12,606,432	D38G	probably damaging	Het
Vsig8	C	A	1: 172,563,283	C411*	probably null	Het
Vwce	A	T	19: 10,664,174	T755S	possibly damaging	Het
Wwp1	T	C	4: 19,611,782	S897G	probably damaging	Het
Zfp111	C	A	7: 24,199,553	C212F	probably damaging	Het
Zfp385b	G	T	2: 77,450,280	H193N	probably damaging	Het
Zfp811	T	C	17: 32,798,781	E95G	probably benign	Het

Other mutations in Adamts18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Adamts18	APN	8	113774943	missense	probably damaging	1.00
IGL01548:Adamts18	APN	8	113764299	missense	probably damaging	1.00
IGL01556:Adamts18	APN	8	113845109	missense	probably benign	0.01
IGL01833:Adamts18	APN	8	113743096	missense	probably benign	0.10
IGL02187:Adamts18	APN	8	113713194	missense	possibly damaging	0.93
IGL02551:Adamts18	APN	8	113699072	missense	probably damaging	1.00
IGL02756:Adamts18	APN	8	113714344	splice site	probably benign
IGL03188:Adamts18	APN	8	113699024	missense	probably damaging	1.00
IGL03411:Adamts18	APN	8	113764297	nonsense	probably null
G1patch:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R0119:Adamts18	UTSW	8	113774953	missense	possibly damaging	0.94
R0378:Adamts18	UTSW	8	113743117	missense	probably damaging	1.00
R0410:Adamts18	UTSW	8	113714358	nonsense	probably null
R0480:Adamts18	UTSW	8	113738818	missense	possibly damaging	0.93
R0514:Adamts18	UTSW	8	113738769	splice site	probably null
R0924:Adamts18	UTSW	8	113705396	splice site	probably null
R0930:Adamts18	UTSW	8	113705396	splice site	probably null
R1333:Adamts18	UTSW	8	113705173	splice site	probably benign
R1441:Adamts18	UTSW	8	113754562	critical splice donor site	probably null
R2082:Adamts18	UTSW	8	113775333	missense	probably damaging	1.00
R2146:Adamts18	UTSW	8	113845003	missense	possibly damaging	0.58
R2371:Adamts18	UTSW	8	113705261	missense	probably benign	0.36
R3148:Adamts18	UTSW	8	113738858	missense	probably damaging	1.00
R3963:Adamts18	UTSW	8	113777811	missense	probably benign	0.00
R4056:Adamts18	UTSW	8	113737580	nonsense	probably null
R4486:Adamts18	UTSW	8	113713193	missense	probably benign	0.00
R4608:Adamts18	UTSW	8	113737613	missense	probably damaging	1.00
R4624:Adamts18	UTSW	8	113773168	nonsense	probably null
R4626:Adamts18	UTSW	8	113773168	nonsense	probably null
R4627:Adamts18	UTSW	8	113773168	nonsense	probably null
R4628:Adamts18	UTSW	8	113773168	nonsense	probably null
R4629:Adamts18	UTSW	8	113773168	nonsense	probably null
R4710:Adamts18	UTSW	8	113706926	missense	probably damaging	0.98
R4959:Adamts18	UTSW	8	113736725	nonsense	probably null
R4973:Adamts18	UTSW	8	113736725	nonsense	probably null
R4976:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5119:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5141:Adamts18	UTSW	8	113775270	missense	probably damaging	1.00
R5422:Adamts18	UTSW	8	113698974	missense	probably benign	0.06
R5587:Adamts18	UTSW	8	113775360	nonsense	probably null
R5868:Adamts18	UTSW	8	113777748	missense	possibly damaging	0.69
R5893:Adamts18	UTSW	8	113773077	missense	probably damaging	1.00
R5906:Adamts18	UTSW	8	113709619	missense	probably benign	0.00
R5942:Adamts18	UTSW	8	113777748	missense	probably benign	0.01
R6006:Adamts18	UTSW	8	113706974	missense	probably damaging	1.00
R6608:Adamts18	UTSW	8	113775279	missense	probably damaging	1.00
R6725:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R7002:Adamts18	UTSW	8	113775290	missense	possibly damaging	0.69
R7292:Adamts18	UTSW	8	113709645	missense	probably benign	0.00
R7411:Adamts18	UTSW	8	113777730	missense	probably damaging	0.99
R7685:Adamts18	UTSW	8	113713223	missense	probably damaging	1.00
R7737:Adamts18	UTSW	8	113736934	splice site	probably null
R7860:Adamts18	UTSW	8	113775276	missense	probably damaging	1.00
R7936:Adamts18	UTSW	8	113767128	missense	probably damaging	1.00
R8197:Adamts18	UTSW	8	113754595	missense	probably damaging	1.00
R8363:Adamts18	UTSW	8	113767163	missense	probably damaging	1.00
R8759:Adamts18	UTSW	8	113706992	missense	probably damaging	1.00
R8934:Adamts18	UTSW	8	113736878	missense	possibly damaging	0.90
R9405:Adamts18	UTSW	8	113703398	missense	probably damaging	1.00
R9422:Adamts18	UTSW	8	113775278	missense	probably damaging	1.00
R9450:Adamts18	UTSW	8	113764310	missense	probably benign	0.10
R9475:Adamts18	UTSW	8	113777938	missense	possibly damaging	0.93
Z1088:Adamts18	UTSW	8	113775440	missense	possibly damaging	0.86
Z1176:Adamts18	UTSW	8	113743168	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GGCTAGAAACCTGTTGGGAC -3'
(R):5'- TGCAGAGGACGCCTATCTAC -3'

Sequencing Primer
(F):5'- TGGGACAATTAAAACCACATACAAG -3'
(R):5'- AGAGGACGCCTATCTACGCTTTG -3'

Posted On

2019-06-26