Incidental Mutation 'R0584:Atp2c2'
ID 56559
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
MMRRC Submission 038774-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0584 (G1)
Quality Score 130
Status Validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120465157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 313 (V313E)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171] [ENSMUST00000212454]
AlphaFold A7L9Z8
Predicted Effect probably benign
Transcript: ENSMUST00000095171
AA Change: V313E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: V313E

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212454
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 79,847,564 (GRCm39) S1745P probably damaging Het
Agfg2 G A 5: 137,665,992 (GRCm39) T89I probably damaging Het
Agtr1a A G 13: 30,565,017 (GRCm39) I27M probably damaging Het
Armh1 A T 4: 117,087,047 (GRCm39) L206Q probably damaging Het
Asxl2 A T 12: 3,546,632 (GRCm39) E472V probably damaging Het
Casp12 A G 9: 5,352,268 (GRCm39) I87V probably null Het
Ccl25 C T 8: 4,404,085 (GRCm39) probably benign Het
Col9a1 T C 1: 24,263,571 (GRCm39) probably benign Het
Cyth4 A G 15: 78,494,078 (GRCm39) probably null Het
Dnah9 A G 11: 65,881,315 (GRCm39) Y2587H probably damaging Het
Dppa3 T C 6: 122,606,951 (GRCm39) I147T probably benign Het
Fam120b T C 17: 15,622,384 (GRCm39) S121P probably damaging Het
Fam209 C T 2: 172,316,081 (GRCm39) T152M probably benign Het
Fam98a A G 17: 75,851,772 (GRCm39) L103P probably damaging Het
Fcho1 T C 8: 72,168,369 (GRCm39) Y218C probably damaging Het
Fitm1 T C 14: 55,814,113 (GRCm39) V203A probably benign Het
Gcn1 G A 5: 115,733,074 (GRCm39) R1037Q probably damaging Het
Gm11563 A G 11: 99,549,451 (GRCm39) I101T unknown Het
Gpd1l A G 9: 114,743,412 (GRCm39) F163L probably damaging Het
Grp C A 18: 66,006,766 (GRCm39) A30E possibly damaging Het
H1f7 C A 15: 98,154,958 (GRCm39) E64* probably null Het
Icosl T C 10: 77,907,709 (GRCm39) Y90H possibly damaging Het
Itsn2 A G 12: 4,747,180 (GRCm39) T1194A probably benign Het
Lrp6 A G 6: 134,433,039 (GRCm39) S1431P probably damaging Het
Ltbp1 T C 17: 75,670,467 (GRCm39) S1503P probably damaging Het
Mef2a G T 7: 66,884,896 (GRCm39) S406* probably null Het
Myh13 G T 11: 67,251,200 (GRCm39) E1360* probably null Het
Nop58 A G 1: 59,745,919 (GRCm39) D400G probably benign Het
Or5p79 T C 7: 108,221,622 (GRCm39) L201P probably benign Het
Or6c205 T C 10: 129,086,817 (GRCm39) V138A probably benign Het
Oscp1 A G 4: 125,977,387 (GRCm39) probably null Het
Pde9a A T 17: 31,678,951 (GRCm39) Y264F probably damaging Het
Pkhd1 T A 1: 20,309,660 (GRCm39) K2763* probably null Het
Prkci T A 3: 31,079,289 (GRCm39) C42* probably null Het
Ptprr T C 10: 116,087,063 (GRCm39) V270A probably damaging Het
Rsf1 T A 7: 97,311,335 (GRCm39) N688K possibly damaging Het
S1pr3 A T 13: 51,573,697 (GRCm39) M293L probably benign Het
Scn10a A C 9: 119,499,597 (GRCm39) L232R probably damaging Het
Sirt5 T A 13: 43,548,204 (GRCm39) probably null Het
Sp6 C T 11: 96,913,091 (GRCm39) T268M probably damaging Het
Spag5 A G 11: 78,194,921 (GRCm39) N76S possibly damaging Het
Tecta T C 9: 42,259,204 (GRCm39) N1560D possibly damaging Het
Togaram1 T C 12: 65,014,279 (GRCm39) L510P probably damaging Het
Umps A G 16: 33,779,494 (GRCm39) I401T probably damaging Het
Vars2 A G 17: 35,977,578 (GRCm39) V118A possibly damaging Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1638:Atp2c2 UTSW 8 120,482,742 (GRCm39) missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6377:Atp2c2 UTSW 8 120,453,093 (GRCm39) missense probably benign 0.10
R6613:Atp2c2 UTSW 8 120,482,760 (GRCm39) missense probably damaging 0.99
R6765:Atp2c2 UTSW 8 120,479,756 (GRCm39) missense probably damaging 1.00
R6836:Atp2c2 UTSW 8 120,461,154 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 120,474,915 (GRCm39) missense probably benign 0.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R8831:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9200:Atp2c2 UTSW 8 120,474,999 (GRCm39) nonsense probably null
R9211:Atp2c2 UTSW 8 120,446,032 (GRCm39) missense probably benign
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 120,465,141 (GRCm39) missense probably benign 0.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 120,472,253 (GRCm39) missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGAATCTTTCAGGCGAGAGGAC -3'
(R):5'- GCACACTCTTATCTAGTCAGGCTACCG -3'

Sequencing Primer
(F):5'- atcctcctgcctcagcc -3'
(R):5'- CATGGACTATACAATGCATCTTCTC -3'
Posted On 2013-07-11