Incidental Mutation 'R7276:Supt16'
ID 565604
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R7276 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52177001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 448 (E448G)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046709
AA Change: E448G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: E448G

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T C 3: 116,968,578 V26A unknown Het
4930546C10Rik C T 18: 68,950,022 W40* probably null Het
Abcc5 T C 16: 20,376,508 probably null Het
Adamts18 T A 8: 113,775,264 M322L probably damaging Het
Ankrd44 T A 1: 54,735,080 N406I probably benign Het
Arhgap35 T G 7: 16,564,568 T191P probably damaging Het
Atg3 G A 16: 45,162,442 E37K possibly damaging Het
Bbs1 A T 19: 4,897,710 probably null Het
BC048562 A G 9: 108,445,236 N60D probably damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
C7 A T 15: 5,011,967 C486S probably damaging Het
Cchcr1 C A 17: 35,529,134 Q634K possibly damaging Het
Cd93 A T 2: 148,441,740 V562E probably damaging Het
Cript T A 17: 87,034,268 Y50* probably null Het
Dnah14 T A 1: 181,685,807 F1908L probably benign Het
Dnah5 A G 15: 28,367,838 N2790D probably damaging Het
Eif3h C A 15: 51,865,321 probably null Het
Ffar3 C G 7: 30,855,848 V16L possibly damaging Het
Gcn1l1 C T 5: 115,611,060 R1884W probably damaging Het
Gm13128 A G 4: 144,332,646 E309G possibly damaging Het
Gpatch1 T A 7: 35,297,496 M426L probably benign Het
Hcn2 T A 10: 79,729,100 Y449N possibly damaging Het
Hdac10 T C 15: 89,128,285 T32A probably benign Het
Hykk T C 9: 54,946,218 Y275H probably damaging Het
Igfn1 G C 1: 135,998,638 P25A possibly damaging Het
Jph1 T C 1: 17,092,042 Q132R probably damaging Het
Kat2b T A 17: 53,624,422 D149E probably damaging Het
Knl1 A T 2: 119,071,686 K1289N probably damaging Het
Lrrc37a G A 11: 103,456,746 S3041L unknown Het
Mtus2 C T 5: 148,076,558 R54C probably benign Het
Myo1d A T 11: 80,693,072 I38N probably damaging Het
Nasp A G 4: 116,614,349 S94P probably damaging Het
Nfat5 C A 8: 107,367,099 N657K probably benign Het
Ngfr A G 11: 95,574,344 L226P probably benign Het
Nos1 T C 5: 117,910,238 S703P probably damaging Het
Nsun7 A G 5: 66,277,141 D275G probably benign Het
Oas1d A G 5: 120,916,881 N172S possibly damaging Het
Olfr1201 T A 2: 88,794,681 F100I probably damaging Het
Olfr1390 T A 11: 49,340,994 M154K probably benign Het
Olfr671 T A 7: 104,975,650 M116L possibly damaging Het
Olfr749 A G 14: 50,736,730 V144A possibly damaging Het
Papss1 A G 3: 131,619,234 E484G probably benign Het
Pcdh15 A G 10: 74,324,392 D447G probably benign Het
Phkg2 A G 7: 127,582,386 E247G possibly damaging Het
Prelid2 T C 18: 41,912,422 N141S possibly damaging Het
Psg18 T C 7: 18,345,984 M431V probably damaging Het
Psmd12 A T 11: 107,503,645 R397* probably null Het
Ralgds G A 2: 28,545,872 R503Q probably damaging Het
Rb1cc1 G A 1: 6,249,192 C945Y probably benign Het
Rgs12 A G 5: 35,026,371 D1026G probably benign Het
Scn7a G A 2: 66,757,162 P66S probably damaging Het
Skiv2l2 A T 13: 112,914,439 Y201N probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tas2r114 T C 6: 131,689,347 I239M probably damaging Het
Tecpr1 C T 5: 144,217,020 W138* probably null Het
Tex101 T C 7: 24,670,404 N45S probably damaging Het
Tmem2 A G 19: 21,835,460 I1010V probably benign Het
Tmx1 C A 12: 70,466,143 T275K possibly damaging Het
Trappc8 T G 18: 20,818,091 I1434L probably damaging Het
Trappc9 G T 15: 73,052,270 H208N probably damaging Het
Trcg1 T A 9: 57,242,579 L478Q probably damaging Het
Trim42 G T 9: 97,369,572 Y91* probably null Het
Vmn2r114 A G 17: 23,290,960 S849P probably damaging Het
Vmn2r120 T C 17: 57,524,881 T303A probably benign Het
Vmn2r13 A G 5: 109,173,779 W351R probably damaging Het
Vmn2r53 T C 7: 12,606,432 D38G probably damaging Het
Vsig8 C A 1: 172,563,283 C411* probably null Het
Vwce A T 19: 10,664,174 T755S possibly damaging Het
Wwp1 T C 4: 19,611,782 S897G probably damaging Het
Zfp111 C A 7: 24,199,553 C212F probably damaging Het
Zfp385b G T 2: 77,450,280 H193N probably damaging Het
Zfp811 T C 17: 32,798,781 E95G probably benign Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
R9048:Supt16 UTSW 14 52181056 missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- TGATAGGACACTAGTGTTTTGCC -3'
(R):5'- AAGAATGTGGGGATTTTCCTGAAG -3'

Sequencing Primer
(F):5'- AACCTTGCATATGTGGTGCCAG -3'
(R):5'- GGATTTTCCTGAAGGTGAGAAAATG -3'
Posted On 2019-06-26