Incidental Mutation 'R7276:C7'
ID565605
Institutional Source Beutler Lab
Gene Symbol C7
Ensembl Gene ENSMUSG00000079105
Gene Namecomplement component 7
SynonymsLOC383055
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7276 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4988762-5063740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5011967 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 486 (C486S)
Ref Sequence ENSEMBL: ENSMUSP00000106317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110689]
Predicted Effect probably damaging
Transcript: ENSMUST00000110689
AA Change: C486S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106317
Gene: ENSMUSG00000079105
AA Change: C486S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSP1 30 80 1.95e-7 SMART
LDLa 84 121 6.53e-9 SMART
MACPF 248 450 9.45e-51 SMART
TSP1 503 551 1.62e-4 SMART
CCP 571 626 1.84e-9 SMART
CCP 631 688 2.23e-8 SMART
FIMAC 699 766 1.63e-24 SMART
FIMAC 773 841 4.65e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serum glycoprotein that forms a membrane attack complex together with complement components C5b, C6, C8, and C9 as part of the terminal complement pathway of the innate immune system. The protein encoded by this gene contains a cholesterol-dependent cytolysin/membrane attack complex/perforin-like (CDC/MACPF) domain and belongs to a large family of structurally related molecules that form pores involved in host immunity and bacterial pathogenesis. This protein initiates membrane attack complex formation by binding the C5b-C6 subcomplex and inserts into the phospholipid bilayer, serving as a membrane anchor. Mutations in this gene are associated with a rare disorder called C7 deficiency. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T C 3: 116,968,578 V26A unknown Het
4930546C10Rik C T 18: 68,950,022 W40* probably null Het
Abcc5 T C 16: 20,376,508 probably null Het
Adamts18 T A 8: 113,775,264 M322L probably damaging Het
Ankrd44 T A 1: 54,735,080 N406I probably benign Het
Arhgap35 T G 7: 16,564,568 T191P probably damaging Het
Atg3 G A 16: 45,162,442 E37K possibly damaging Het
Bbs1 A T 19: 4,897,710 probably null Het
BC048562 A G 9: 108,445,236 N60D probably damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
Cchcr1 C A 17: 35,529,134 Q634K possibly damaging Het
Cd93 A T 2: 148,441,740 V562E probably damaging Het
Cript T A 17: 87,034,268 Y50* probably null Het
Dnah14 T A 1: 181,685,807 F1908L probably benign Het
Dnah5 A G 15: 28,367,838 N2790D probably damaging Het
Eif3h C A 15: 51,865,321 probably null Het
Ffar3 C G 7: 30,855,848 V16L possibly damaging Het
Gcn1l1 C T 5: 115,611,060 R1884W probably damaging Het
Gm13128 A G 4: 144,332,646 E309G possibly damaging Het
Gpatch1 T A 7: 35,297,496 M426L probably benign Het
Hcn2 T A 10: 79,729,100 Y449N possibly damaging Het
Hdac10 T C 15: 89,128,285 T32A probably benign Het
Hykk T C 9: 54,946,218 Y275H probably damaging Het
Igfn1 G C 1: 135,998,638 P25A possibly damaging Het
Jph1 T C 1: 17,092,042 Q132R probably damaging Het
Kat2b T A 17: 53,624,422 D149E probably damaging Het
Knl1 A T 2: 119,071,686 K1289N probably damaging Het
Lrrc37a G A 11: 103,456,746 S3041L unknown Het
Mtus2 C T 5: 148,076,558 R54C probably benign Het
Myo1d A T 11: 80,693,072 I38N probably damaging Het
Nasp A G 4: 116,614,349 S94P probably damaging Het
Nfat5 C A 8: 107,367,099 N657K probably benign Het
Ngfr A G 11: 95,574,344 L226P probably benign Het
Nos1 T C 5: 117,910,238 S703P probably damaging Het
Nsun7 A G 5: 66,277,141 D275G probably benign Het
Oas1d A G 5: 120,916,881 N172S possibly damaging Het
Olfr1201 T A 2: 88,794,681 F100I probably damaging Het
Olfr1390 T A 11: 49,340,994 M154K probably benign Het
Olfr671 T A 7: 104,975,650 M116L possibly damaging Het
Olfr749 A G 14: 50,736,730 V144A possibly damaging Het
Papss1 A G 3: 131,619,234 E484G probably benign Het
Pcdh15 A G 10: 74,324,392 D447G probably benign Het
Phkg2 A G 7: 127,582,386 E247G possibly damaging Het
Prelid2 T C 18: 41,912,422 N141S possibly damaging Het
Psg18 T C 7: 18,345,984 M431V probably damaging Het
Psmd12 A T 11: 107,503,645 R397* probably null Het
Ralgds G A 2: 28,545,872 R503Q probably damaging Het
Rb1cc1 G A 1: 6,249,192 C945Y probably benign Het
Rgs12 A G 5: 35,026,371 D1026G probably benign Het
Scn7a G A 2: 66,757,162 P66S probably damaging Het
Skiv2l2 A T 13: 112,914,439 Y201N probably benign Het
Supt16 T C 14: 52,177,001 E448G probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tas2r114 T C 6: 131,689,347 I239M probably damaging Het
Tecpr1 C T 5: 144,217,020 W138* probably null Het
Tex101 T C 7: 24,670,404 N45S probably damaging Het
Tmem2 A G 19: 21,835,460 I1010V probably benign Het
Tmx1 C A 12: 70,466,143 T275K possibly damaging Het
Trappc8 T G 18: 20,818,091 I1434L probably damaging Het
Trappc9 G T 15: 73,052,270 H208N probably damaging Het
Trcg1 T A 9: 57,242,579 L478Q probably damaging Het
Trim42 G T 9: 97,369,572 Y91* probably null Het
Vmn2r114 A G 17: 23,290,960 S849P probably damaging Het
Vmn2r120 T C 17: 57,524,881 T303A probably benign Het
Vmn2r13 A G 5: 109,173,779 W351R probably damaging Het
Vmn2r53 T C 7: 12,606,432 D38G probably damaging Het
Vsig8 C A 1: 172,563,283 C411* probably null Het
Vwce A T 19: 10,664,174 T755S possibly damaging Het
Wwp1 T C 4: 19,611,782 S897G probably damaging Het
Zfp111 C A 7: 24,199,553 C212F probably damaging Het
Zfp385b G T 2: 77,450,280 H193N probably damaging Het
Zfp811 T C 17: 32,798,781 E95G probably benign Het
Other mutations in C7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:C7 APN 15 5059389 splice site probably benign
IGL02803:C7 APN 15 5049560 missense probably damaging 1.00
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0271:C7 UTSW 15 5015380 missense possibly damaging 0.81
R0360:C7 UTSW 15 4988962 missense probably benign 0.00
R0433:C7 UTSW 15 4988916 missense probably damaging 1.00
R0505:C7 UTSW 15 4994142 splice site probably benign
R1056:C7 UTSW 15 5045778 missense possibly damaging 0.89
R1443:C7 UTSW 15 5059419 missense probably benign 0.01
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1700:C7 UTSW 15 5002792 nonsense probably null
R1774:C7 UTSW 15 5012075 missense probably damaging 0.99
R1801:C7 UTSW 15 5012021 missense possibly damaging 0.61
R1809:C7 UTSW 15 5034339 missense probably damaging 0.99
R1986:C7 UTSW 15 5012012 missense possibly damaging 0.94
R2037:C7 UTSW 15 5034238 nonsense probably null
R2047:C7 UTSW 15 5045661 missense probably damaging 1.00
R2073:C7 UTSW 15 4990428 missense probably benign 0.09
R3972:C7 UTSW 15 5007651 missense possibly damaging 0.77
R4080:C7 UTSW 15 4990464 missense probably benign 0.09
R4200:C7 UTSW 15 4990309 critical splice donor site probably null
R4576:C7 UTSW 15 5002756 missense probably damaging 1.00
R4815:C7 UTSW 15 5059405 missense probably benign 0.16
R4995:C7 UTSW 15 5049592 missense probably damaging 1.00
R5300:C7 UTSW 15 5031950 missense probably damaging 1.00
R5562:C7 UTSW 15 5031915 nonsense probably null
R5708:C7 UTSW 15 5015401 missense possibly damaging 0.90
R5740:C7 UTSW 15 5057040 missense probably benign 0.00
R5873:C7 UTSW 15 5005235 missense probably damaging 1.00
R6222:C7 UTSW 15 5011941 missense possibly damaging 0.89
R6516:C7 UTSW 15 5057081 missense probably damaging 0.98
R6810:C7 UTSW 15 5007654 missense probably damaging 0.98
R7019:C7 UTSW 15 5045682 missense probably benign 0.04
R7199:C7 UTSW 15 4994243 missense probably benign 0.09
R7422:C7 UTSW 15 5012056 missense probably benign 0.13
R7652:C7 UTSW 15 5012105 missense probably damaging 1.00
R7783:C7 UTSW 15 5007710 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACCTCAGAAGCTACGATGTGG -3'
(R):5'- TCGGAGTCCTGACTGACTTC -3'

Sequencing Primer
(F):5'- CCTCAGAAGCTACGATGTGGAGATG -3'
(R):5'- CCGTTGTATGAGCTGGTCAAG -3'
Posted On2019-06-26