Mutagenetix > Incidental Mutation

Incidental Mutation 'R7276:Trappc9'

565607

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7276 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 73052270 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 208 (H208N)

Ref Sequence

ENSEMBL: ENSMUSP00000087202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000023276
AA Change: H20N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: H20N

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089770
AA Change: H208N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: H208N

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168191
AA Change: H208N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: H208N

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	810	3.7e-222	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170633
AA Change: H208N

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: H208N

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000228960
AA Change: H208N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (74/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930455H04Rik	T	C	3: 116,968,578	V26A	unknown	Het
4930546C10Rik	C	T	18: 68,950,022	W40*	probably null	Het
Abcc5	T	C	16: 20,376,508		probably null	Het
Adamts18	T	A	8: 113,775,264	M322L	probably damaging	Het
Ankrd44	T	A	1: 54,735,080	N406I	probably benign	Het
Arhgap35	T	G	7: 16,564,568	T191P	probably damaging	Het
Atg3	G	A	16: 45,162,442	E37K	possibly damaging	Het
Bbs1	A	T	19: 4,897,710		probably null	Het
BC048562	A	G	9: 108,445,236	N60D	probably damaging	Het
Btnl9	T	A	11: 49,175,790	I335F	probably benign	Het
C7	A	T	15: 5,011,967	C486S	probably damaging	Het
Cchcr1	C	A	17: 35,529,134	Q634K	possibly damaging	Het
Cd93	A	T	2: 148,441,740	V562E	probably damaging	Het
Cript	T	A	17: 87,034,268	Y50*	probably null	Het
Dnah14	T	A	1: 181,685,807	F1908L	probably benign	Het
Dnah5	A	G	15: 28,367,838	N2790D	probably damaging	Het
Eif3h	C	A	15: 51,865,321		probably null	Het
Ffar3	C	G	7: 30,855,848	V16L	possibly damaging	Het
Gcn1l1	C	T	5: 115,611,060	R1884W	probably damaging	Het
Gm13128	A	G	4: 144,332,646	E309G	possibly damaging	Het
Gpatch1	T	A	7: 35,297,496	M426L	probably benign	Het
Hcn2	T	A	10: 79,729,100	Y449N	possibly damaging	Het
Hdac10	T	C	15: 89,128,285	T32A	probably benign	Het
Hykk	T	C	9: 54,946,218	Y275H	probably damaging	Het
Igfn1	G	C	1: 135,998,638	P25A	possibly damaging	Het
Jph1	T	C	1: 17,092,042	Q132R	probably damaging	Het
Kat2b	T	A	17: 53,624,422	D149E	probably damaging	Het
Knl1	A	T	2: 119,071,686	K1289N	probably damaging	Het
Lrrc37a	G	A	11: 103,456,746	S3041L	unknown	Het
Mtus2	C	T	5: 148,076,558	R54C	probably benign	Het
Myo1d	A	T	11: 80,693,072	I38N	probably damaging	Het
Nasp	A	G	4: 116,614,349	S94P	probably damaging	Het
Nfat5	C	A	8: 107,367,099	N657K	probably benign	Het
Ngfr	A	G	11: 95,574,344	L226P	probably benign	Het
Nos1	T	C	5: 117,910,238	S703P	probably damaging	Het
Nsun7	A	G	5: 66,277,141	D275G	probably benign	Het
Oas1d	A	G	5: 120,916,881	N172S	possibly damaging	Het
Olfr1201	T	A	2: 88,794,681	F100I	probably damaging	Het
Olfr1390	T	A	11: 49,340,994	M154K	probably benign	Het
Olfr671	T	A	7: 104,975,650	M116L	possibly damaging	Het
Olfr749	A	G	14: 50,736,730	V144A	possibly damaging	Het
Papss1	A	G	3: 131,619,234	E484G	probably benign	Het
Pcdh15	A	G	10: 74,324,392	D447G	probably benign	Het
Phkg2	A	G	7: 127,582,386	E247G	possibly damaging	Het
Prelid2	T	C	18: 41,912,422	N141S	possibly damaging	Het
Psg18	T	C	7: 18,345,984	M431V	probably damaging	Het
Psmd12	A	T	11: 107,503,645	R397*	probably null	Het
Ralgds	G	A	2: 28,545,872	R503Q	probably damaging	Het
Rb1cc1	G	A	1: 6,249,192	C945Y	probably benign	Het
Rgs12	A	G	5: 35,026,371	D1026G	probably benign	Het
Scn7a	G	A	2: 66,757,162	P66S	probably damaging	Het
Skiv2l2	A	T	13: 112,914,439	Y201N	probably benign	Het
Supt16	T	C	14: 52,177,001	E448G	probably benign	Het
Syt16	C	T	12: 74,266,709	R470C	probably damaging	Het
Tas2r114	T	C	6: 131,689,347	I239M	probably damaging	Het
Tecpr1	C	T	5: 144,217,020	W138*	probably null	Het
Tex101	T	C	7: 24,670,404	N45S	probably damaging	Het
Tmem2	A	G	19: 21,835,460	I1010V	probably benign	Het
Tmx1	C	A	12: 70,466,143	T275K	possibly damaging	Het
Trappc8	T	G	18: 20,818,091	I1434L	probably damaging	Het
Trcg1	T	A	9: 57,242,579	L478Q	probably damaging	Het
Trim42	G	T	9: 97,369,572	Y91*	probably null	Het
Vmn2r114	A	G	17: 23,290,960	S849P	probably damaging	Het
Vmn2r120	T	C	17: 57,524,881	T303A	probably benign	Het
Vmn2r13	A	G	5: 109,173,779	W351R	probably damaging	Het
Vmn2r53	T	C	7: 12,606,432	D38G	probably damaging	Het
Vsig8	C	A	1: 172,563,283	C411*	probably null	Het
Vwce	A	T	19: 10,664,174	T755S	possibly damaging	Het
Wwp1	T	C	4: 19,611,782	S897G	probably damaging	Het
Zfp111	C	A	7: 24,199,553	C212F	probably damaging	Het
Zfp385b	G	T	2: 77,450,280	H193N	probably damaging	Het
Zfp811	T	C	17: 32,798,781	E95G	probably benign	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Earl	UTSW	15	72736777	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9083:Trappc9	UTSW	15	72736777	nonsense	probably null
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
R9723:Trappc9	UTSW	15	72590114	missense	possibly damaging	0.87
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- TGAGCCCACAGAGCAATTAGC -3'
(R):5'- TGGCTTCCAACCTTAGAGCC -3'

Sequencing Primer
(F):5'- CTCTCTTTGTGCCATTTCCTCATAG -3'
(R):5'- GCCTAACACCGGCTTCTCAG -3'

Posted On

2019-06-26