Incidental Mutation 'R7276:Cchcr1'
ID565612
Institutional Source Beutler Lab
Gene Symbol Cchcr1
Ensembl Gene ENSMUSG00000040312
Gene Namecoiled-coil alpha-helical rod protein 1
SynonymsHcr
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R7276 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location35517100-35531015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35529134 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 634 (Q634K)
Ref Sequence ENSEMBL: ENSMUSP00000132028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025273] [ENSMUST00000045956] [ENSMUST00000164242] [ENSMUST00000173903]
Predicted Effect probably benign
Transcript: ENSMUST00000025273
SMART Domains Protein: ENSMUSP00000025273
Gene: ENSMUSG00000024409

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:SPR1 22 135 1.3e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000045956
AA Change: Q634K

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046612
Gene: ENSMUSG00000040312
AA Change: Q634K

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164242
AA Change: Q634K

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132028
Gene: ENSMUSG00000040312
AA Change: Q634K

DomainStartEndE-ValueType
Pfam:HCR 27 767 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173903
AA Change: Q717K

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133407
Gene: ENSMUSG00000040312
AA Change: Q717K

DomainStartEndE-ValueType
Pfam:HCR 110 855 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930455H04Rik T C 3: 116,968,578 V26A unknown Het
4930546C10Rik C T 18: 68,950,022 W40* probably null Het
Abcc5 T C 16: 20,376,508 probably null Het
Adamts18 T A 8: 113,775,264 M322L probably damaging Het
Ankrd44 T A 1: 54,735,080 N406I probably benign Het
Arhgap35 T G 7: 16,564,568 T191P probably damaging Het
Atg3 G A 16: 45,162,442 E37K possibly damaging Het
Bbs1 A T 19: 4,897,710 probably null Het
BC048562 A G 9: 108,445,236 N60D probably damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
C7 A T 15: 5,011,967 C486S probably damaging Het
Cd93 A T 2: 148,441,740 V562E probably damaging Het
Cript T A 17: 87,034,268 Y50* probably null Het
Dnah14 T A 1: 181,685,807 F1908L probably benign Het
Dnah5 A G 15: 28,367,838 N2790D probably damaging Het
Eif3h C A 15: 51,865,321 probably null Het
Ffar3 C G 7: 30,855,848 V16L possibly damaging Het
Gcn1l1 C T 5: 115,611,060 R1884W probably damaging Het
Gm13128 A G 4: 144,332,646 E309G possibly damaging Het
Gpatch1 T A 7: 35,297,496 M426L probably benign Het
Hcn2 T A 10: 79,729,100 Y449N possibly damaging Het
Hdac10 T C 15: 89,128,285 T32A probably benign Het
Hykk T C 9: 54,946,218 Y275H probably damaging Het
Igfn1 G C 1: 135,998,638 P25A possibly damaging Het
Jph1 T C 1: 17,092,042 Q132R probably damaging Het
Kat2b T A 17: 53,624,422 D149E probably damaging Het
Knl1 A T 2: 119,071,686 K1289N probably damaging Het
Lrrc37a G A 11: 103,456,746 S3041L unknown Het
Mtus2 C T 5: 148,076,558 R54C probably benign Het
Myo1d A T 11: 80,693,072 I38N probably damaging Het
Nasp A G 4: 116,614,349 S94P probably damaging Het
Nfat5 C A 8: 107,367,099 N657K probably benign Het
Ngfr A G 11: 95,574,344 L226P probably benign Het
Nos1 T C 5: 117,910,238 S703P probably damaging Het
Nsun7 A G 5: 66,277,141 D275G probably benign Het
Oas1d A G 5: 120,916,881 N172S possibly damaging Het
Olfr1201 T A 2: 88,794,681 F100I probably damaging Het
Olfr1390 T A 11: 49,340,994 M154K probably benign Het
Olfr671 T A 7: 104,975,650 M116L possibly damaging Het
Olfr749 A G 14: 50,736,730 V144A possibly damaging Het
Papss1 A G 3: 131,619,234 E484G probably benign Het
Pcdh15 A G 10: 74,324,392 D447G probably benign Het
Phkg2 A G 7: 127,582,386 E247G possibly damaging Het
Prelid2 T C 18: 41,912,422 N141S possibly damaging Het
Psg18 T C 7: 18,345,984 M431V probably damaging Het
Psmd12 A T 11: 107,503,645 R397* probably null Het
Ralgds G A 2: 28,545,872 R503Q probably damaging Het
Rb1cc1 G A 1: 6,249,192 C945Y probably benign Het
Rgs12 A G 5: 35,026,371 D1026G probably benign Het
Scn7a G A 2: 66,757,162 P66S probably damaging Het
Skiv2l2 A T 13: 112,914,439 Y201N probably benign Het
Supt16 T C 14: 52,177,001 E448G probably benign Het
Syt16 C T 12: 74,266,709 R470C probably damaging Het
Tas2r114 T C 6: 131,689,347 I239M probably damaging Het
Tecpr1 C T 5: 144,217,020 W138* probably null Het
Tex101 T C 7: 24,670,404 N45S probably damaging Het
Tmem2 A G 19: 21,835,460 I1010V probably benign Het
Tmx1 C A 12: 70,466,143 T275K possibly damaging Het
Trappc8 T G 18: 20,818,091 I1434L probably damaging Het
Trappc9 G T 15: 73,052,270 H208N probably damaging Het
Trcg1 T A 9: 57,242,579 L478Q probably damaging Het
Trim42 G T 9: 97,369,572 Y91* probably null Het
Vmn2r114 A G 17: 23,290,960 S849P probably damaging Het
Vmn2r120 T C 17: 57,524,881 T303A probably benign Het
Vmn2r13 A G 5: 109,173,779 W351R probably damaging Het
Vmn2r53 T C 7: 12,606,432 D38G probably damaging Het
Vsig8 C A 1: 172,563,283 C411* probably null Het
Vwce A T 19: 10,664,174 T755S possibly damaging Het
Wwp1 T C 4: 19,611,782 S897G probably damaging Het
Zfp111 C A 7: 24,199,553 C212F probably damaging Het
Zfp385b G T 2: 77,450,280 H193N probably damaging Het
Zfp811 T C 17: 32,798,781 E95G probably benign Het
Other mutations in Cchcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Cchcr1 APN 17 35528572 missense possibly damaging 0.92
IGL02723:Cchcr1 APN 17 35530802 missense probably benign 0.00
IGL02806:Cchcr1 APN 17 35525256 splice site probably benign
IGL03055:Cchcr1 UTSW 17 35526619 missense probably benign 0.33
R0569:Cchcr1 UTSW 17 35528968 critical splice donor site probably null
R1438:Cchcr1 UTSW 17 35530560 critical splice donor site probably null
R2055:Cchcr1 UTSW 17 35526420 missense probably damaging 1.00
R2511:Cchcr1 UTSW 17 35530513 missense probably benign 0.01
R3910:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R3911:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R3913:Cchcr1 UTSW 17 35525336 missense probably damaging 1.00
R5590:Cchcr1 UTSW 17 35526680 missense probably damaging 1.00
R5821:Cchcr1 UTSW 17 35528848 missense probably damaging 1.00
R5940:Cchcr1 UTSW 17 35524993 missense probably damaging 1.00
R5941:Cchcr1 UTSW 17 35524993 missense probably damaging 1.00
R6006:Cchcr1 UTSW 17 35524700 missense possibly damaging 0.83
R6114:Cchcr1 UTSW 17 35525330 missense probably damaging 0.98
R6146:Cchcr1 UTSW 17 35528578 missense possibly damaging 0.92
R6262:Cchcr1 UTSW 17 35530516 missense probably benign 0.04
R6369:Cchcr1 UTSW 17 35528176 missense probably damaging 0.99
R6478:Cchcr1 UTSW 17 35524703 missense possibly damaging 0.71
R6827:Cchcr1 UTSW 17 35530405 missense possibly damaging 0.71
R6860:Cchcr1 UTSW 17 35529118 missense possibly damaging 0.85
R7109:Cchcr1 UTSW 17 35517941 critical splice donor site probably null
R7341:Cchcr1 UTSW 17 35526713 missense probably benign 0.00
R7404:Cchcr1 UTSW 17 35524796 missense probably benign 0.09
R7472:Cchcr1 UTSW 17 35528351 missense probably damaging 1.00
R7666:Cchcr1 UTSW 17 35526486 missense probably benign 0.01
X0025:Cchcr1 UTSW 17 35526676 missense probably benign 0.13
Z1177:Cchcr1 UTSW 17 35528663 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATCTACGGGCAAGGTGTGG -3'
(R):5'- ACTTCGCTACATACACTTGTCAAC -3'

Sequencing Primer
(F):5'- CAAGGTGTGGGGGCGTG -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'
Posted On2019-06-26