Incidental Mutation 'R7318:Chrnb2'
ID565630
Institutional Source Beutler Lab
Gene Symbol Chrnb2
Ensembl Gene ENSMUSG00000027950
Gene Namecholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)
SynonymsC030030P04Rik, Acrb2, Acrb-2, [b]2-nAchR
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R7318 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89746195-89764632 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 89763367 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029562] [ENSMUST00000200558]
Predicted Effect probably null
Transcript: ENSMUST00000029562
SMART Domains Protein: ENSMUSP00000029562
Gene: ENSMUSG00000027950

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 29 234 5.6e-75 PFAM
Pfam:Neur_chan_memb 241 477 1.7e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200558
SMART Domains Protein: ENSMUSP00000143441
Gene: ENSMUSG00000027950

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Neur_chan_LBD 29 234 1.5e-71 PFAM
Pfam:Neur_chan_memb 241 454 4.8e-61 PFAM
low complexity region 657 666 N/A INTRINSIC
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neuronal acetylcholine receptors are homo- or heteropentameric complexes composed of homologous alpha and beta subunits. They belong to a superfamily of ligand-gated ion channels which allow the flow of sodium and potassium across the plasma membrane in response to ligands such as acetylcholine and nicotine. This gene encodes one of several beta subunits. Mutations in this gene are associated with autosomal dominant nocturnal frontal lobe epilepsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have impaired responses to nicotine, but show improved passive avoidance behavior. With age, mutants show more neurodegeneration and alterations of the visual system, with decreased cortical visual acuity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,687 L260S probably benign Het
9130230L23Rik A T 5: 65,988,428 S113R unknown Het
Abcc5 G A 16: 20,392,543 P557S probably benign Het
Acad11 A G 9: 104,081,267 T245A probably damaging Het
Acap2 A G 16: 31,127,337 F263L probably damaging Het
Ankle2 A T 5: 110,237,766 N327I probably benign Het
Appl1 T C 14: 26,963,660 E67G probably benign Het
Arfgef3 A T 10: 18,630,463 C864S possibly damaging Het
Arhgap20 A G 9: 51,840,502 I418V probably benign Het
Arhgef2 A T 3: 88,632,303 N102Y probably damaging Het
Car9 G T 4: 43,513,089 E431D probably damaging Het
Cbfa2t2 T C 2: 154,500,454 I30T probably benign Het
Cd40 A T 2: 165,062,335 D34V possibly damaging Het
Chsy1 T G 7: 66,110,229 probably null Het
Cpne6 A G 14: 55,514,294 T245A possibly damaging Het
Cpsf1 T A 15: 76,597,275 K1159* probably null Het
Crisp1 T A 17: 40,307,777 E64D possibly damaging Het
D3Ertd751e A G 3: 41,802,551 probably null Het
Dnah7b T A 1: 46,195,372 L1488Q probably damaging Het
Dnm2 G A 9: 21,505,567 G799R possibly damaging Het
E330009J07Rik A G 6: 40,409,164 V333A possibly damaging Het
Elp2 G A 18: 24,606,899 V61I probably damaging Het
Epb41l3 T C 17: 69,266,140 L388P Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fry A T 5: 150,436,993 S2035C probably damaging Het
Gas8 T C 8: 123,530,968 F385L probably benign Het
Ghsr T C 3: 27,372,467 V224A possibly damaging Het
Gstp2 T A 19: 4,041,065 R85W probably benign Het
Ighv1-20 T A 12: 114,724,190 I6F possibly damaging Het
Inpp4b T A 8: 82,071,745 M854K probably damaging Het
Kif15 A G 9: 122,987,949 E538G probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lmo3 T A 6: 138,421,365 probably benign Het
Lyg1 G A 1: 37,949,855 P95S probably benign Het
Lyst A G 13: 13,757,443 H3552R probably benign Het
Mtif2 C T 11: 29,540,115 S385L probably benign Het
Muc4 A T 16: 32,755,336 I1737F unknown Het
Mug1 T C 6: 121,870,652 probably null Het
Mx1 G T 16: 97,452,086 Q350K probably benign Het
Mylk3 G T 8: 85,359,097 D269E probably benign Het
Myo3a A T 2: 22,558,320 K974* probably null Het
Nectin4 G T 1: 171,380,463 R141L probably benign Het
Nlgn2 T C 11: 69,825,969 H582R probably damaging Het
Olfr558 T A 7: 102,710,019 Y253* probably null Het
Olfr613 T A 7: 103,552,091 M102K probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psmd11 C A 11: 80,456,302 L171I probably benign Het
Rad54l A G 4: 116,110,709 V152A possibly damaging Het
Ranbp2 T A 10: 58,483,087 Y2473* probably null Het
Sertad1 T C 7: 27,489,485 I77T possibly damaging Het
Sesn3 A T 9: 14,308,577 E87D probably damaging Het
Slc30a5 A T 13: 100,813,969 S260R probably benign Het
Slc6a12 G A 6: 121,352,013 G111S probably damaging Het
Slc6a12 T C 6: 121,352,019 Y113H probably benign Het
Spag17 T G 3: 99,939,983 M76R probably benign Het
Stard13 G A 5: 151,062,573 Q491* probably null Het
Synpo2 T C 3: 123,117,319 S226G probably benign Het
Tada2b G A 5: 36,483,987 T24I probably benign Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Tnnt1 T A 7: 4,510,548 probably null Het
Usp17lb T C 7: 104,841,133 I196V probably benign Het
Utp20 T A 10: 88,813,949 K466N possibly damaging Het
Wdr46 T C 17: 33,941,885 probably null Het
Zfp287 T A 11: 62,714,278 Q601L probably damaging Het
Zfp410 T C 12: 84,325,690 S97P probably benign Het
Other mutations in Chrnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03108:Chrnb2 APN 3 89763374 splice site probably benign
IGL03117:Chrnb2 APN 3 89763245 missense probably damaging 1.00
IGL03391:Chrnb2 APN 3 89760877 missense probably damaging 0.98
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0131:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R0132:Chrnb2 UTSW 3 89764406 start codon destroyed probably null 0.01
R1726:Chrnb2 UTSW 3 89761202 missense probably damaging 1.00
R2095:Chrnb2 UTSW 3 89761437 missense probably benign 0.01
R2124:Chrnb2 UTSW 3 89769341 unclassified probably benign
R3548:Chrnb2 UTSW 3 89761591 missense probably benign 0.04
R4212:Chrnb2 UTSW 3 89761544 missense probably damaging 1.00
R4902:Chrnb2 UTSW 3 89760941 missense probably damaging 1.00
R6307:Chrnb2 UTSW 3 89761524 missense probably damaging 1.00
R6751:Chrnb2 UTSW 3 89761576 missense probably damaging 1.00
R6999:Chrnb2 UTSW 3 89761315 missense possibly damaging 0.71
R7826:Chrnb2 UTSW 3 89763243 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCTTTCTGACTGGGCTGAC -3'
(R):5'- AGTCCTTGCAGAATGGTGTC -3'

Sequencing Primer
(F):5'- CTGACTGGGCTGACTATTGTAAC -3'
(R):5'- CAGAATGGTGTCTCTTTGGAGC -3'
Posted On2019-06-26