Incidental Mutation 'R7318:Inpp4b'
ID565654
Institutional Source Beutler Lab
Gene Symbol Inpp4b
Ensembl Gene ENSMUSG00000037940
Gene Nameinositol polyphosphate-4-phosphatase, type II
SynonymsE130107I17Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R7318 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location81342556-82127914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82071745 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 854 (M854K)
Ref Sequence ENSEMBL: ENSMUSP00000150541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042529] [ENSMUST00000109851] [ENSMUST00000109852] [ENSMUST00000169116] [ENSMUST00000169387] [ENSMUST00000170160] [ENSMUST00000172031] [ENSMUST00000213285] [ENSMUST00000215332] [ENSMUST00000217122]
Predicted Effect probably damaging
Transcript: ENSMUST00000042529
AA Change: M837K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044466
Gene: ENSMUSG00000037940
AA Change: M837K

DomainStartEndE-ValueType
C2 40 147 1.72e0 SMART
low complexity region 302 319 N/A INTRINSIC
low complexity region 425 434 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109851
AA Change: M722K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105477
Gene: ENSMUSG00000037940
AA Change: M722K

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
low complexity region 187 204 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
transmembrane domain 783 805 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109852
AA Change: M854K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105478
Gene: ENSMUSG00000037940
AA Change: M854K

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
transmembrane domain 915 937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169116
SMART Domains Protein: ENSMUSP00000131947
Gene: ENSMUSG00000037940

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169387
Predicted Effect probably benign
Transcript: ENSMUST00000170160
SMART Domains Protein: ENSMUSP00000132156
Gene: ENSMUSG00000037940

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
low complexity region 257 266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172031
AA Change: M854K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131324
Gene: ENSMUSG00000037940
AA Change: M854K

DomainStartEndE-ValueType
C2 40 164 5.29e0 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 442 451 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213285
Predicted Effect probably damaging
Transcript: ENSMUST00000215332
AA Change: M854K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217122
AA Change: M854K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8001 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INPP4B encodes the inositol polyphosphate 4-phosphatase type II, one of the enzymes involved in phosphatidylinositol signaling pathways. This enzyme removes the phosphate group at position 4 of the inositol ring from inositol 3,4-bisphosphate. There is limited data to suggest that the human type II enzyme is subject to alternative splicing, as has been established for the type I enzyme. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit osteoporosis, reduced long bone length, increased osteoclast numbers and size, increased osteoblast numbers, and increased bone resorption and resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,687 L260S probably benign Het
9130230L23Rik A T 5: 65,988,428 S113R unknown Het
Abcc5 G A 16: 20,392,543 P557S probably benign Het
Acad11 A G 9: 104,081,267 T245A probably damaging Het
Acap2 A G 16: 31,127,337 F263L probably damaging Het
Ankle2 A T 5: 110,237,766 N327I probably benign Het
Appl1 T C 14: 26,963,660 E67G probably benign Het
Arfgef3 A T 10: 18,630,463 C864S possibly damaging Het
Arhgap20 A G 9: 51,840,502 I418V probably benign Het
Arhgef2 A T 3: 88,632,303 N102Y probably damaging Het
Car9 G T 4: 43,513,089 E431D probably damaging Het
Cbfa2t2 T C 2: 154,500,454 I30T probably benign Het
Cd40 A T 2: 165,062,335 D34V possibly damaging Het
Chrnb2 T A 3: 89,763,367 probably null Het
Chsy1 T G 7: 66,110,229 probably null Het
Cpne6 A G 14: 55,514,294 T245A possibly damaging Het
Cpsf1 T A 15: 76,597,275 K1159* probably null Het
Crisp1 T A 17: 40,307,777 E64D possibly damaging Het
D3Ertd751e A G 3: 41,802,551 probably null Het
Dnah7b T A 1: 46,195,372 L1488Q probably damaging Het
Dnm2 G A 9: 21,505,567 G799R possibly damaging Het
E330009J07Rik A G 6: 40,409,164 V333A possibly damaging Het
Elp2 G A 18: 24,606,899 V61I probably damaging Het
Epb41l3 T C 17: 69,266,140 L388P Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fry A T 5: 150,436,993 S2035C probably damaging Het
Gas8 T C 8: 123,530,968 F385L probably benign Het
Ghsr T C 3: 27,372,467 V224A possibly damaging Het
Gstp2 T A 19: 4,041,065 R85W probably benign Het
Ighv1-20 T A 12: 114,724,190 I6F possibly damaging Het
Kif15 A G 9: 122,987,949 E538G probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lmo3 T A 6: 138,421,365 probably benign Het
Lyg1 G A 1: 37,949,855 P95S probably benign Het
Lyst A G 13: 13,757,443 H3552R probably benign Het
Mtif2 C T 11: 29,540,115 S385L probably benign Het
Muc4 A T 16: 32,755,336 I1737F unknown Het
Mug1 T C 6: 121,870,652 probably null Het
Mx1 G T 16: 97,452,086 Q350K probably benign Het
Mylk3 G T 8: 85,359,097 D269E probably benign Het
Myo3a A T 2: 22,558,320 K974* probably null Het
Nectin4 G T 1: 171,380,463 R141L probably benign Het
Nlgn2 T C 11: 69,825,969 H582R probably damaging Het
Olfr558 T A 7: 102,710,019 Y253* probably null Het
Olfr613 T A 7: 103,552,091 M102K probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psmd11 C A 11: 80,456,302 L171I probably benign Het
Rad54l A G 4: 116,110,709 V152A possibly damaging Het
Ranbp2 T A 10: 58,483,087 Y2473* probably null Het
Sertad1 T C 7: 27,489,485 I77T possibly damaging Het
Sesn3 A T 9: 14,308,577 E87D probably damaging Het
Slc30a5 A T 13: 100,813,969 S260R probably benign Het
Slc6a12 G A 6: 121,352,013 G111S probably damaging Het
Slc6a12 T C 6: 121,352,019 Y113H probably benign Het
Spag17 T G 3: 99,939,983 M76R probably benign Het
Stard13 G A 5: 151,062,573 Q491* probably null Het
Synpo2 T C 3: 123,117,319 S226G probably benign Het
Tada2b G A 5: 36,483,987 T24I probably benign Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Tnnt1 T A 7: 4,510,548 probably null Het
Usp17lb T C 7: 104,841,133 I196V probably benign Het
Utp20 T A 10: 88,813,949 K466N possibly damaging Het
Wdr46 T C 17: 33,941,885 probably null Het
Zfp287 T A 11: 62,714,278 Q601L probably damaging Het
Zfp410 T C 12: 84,325,690 S97P probably benign Het
Other mutations in Inpp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Inpp4b APN 8 81856750 missense probably damaging 1.00
IGL01481:Inpp4b APN 8 81997380 missense probably damaging 1.00
IGL01509:Inpp4b APN 8 81890703 splice site probably benign
IGL01515:Inpp4b APN 8 81952711 missense possibly damaging 0.68
IGL01607:Inpp4b APN 8 82010663 missense probably benign 0.03
IGL01643:Inpp4b APN 8 82071771 missense probably damaging 0.97
IGL01736:Inpp4b APN 8 81997339 missense probably benign 0.00
IGL02154:Inpp4b APN 8 81969501 splice site probably benign
IGL02327:Inpp4b APN 8 82041962 missense probably benign 0.01
IGL02413:Inpp4b APN 8 82033171 missense probably benign
IGL02652:Inpp4b APN 8 81770800 splice site probably benign
IGL02678:Inpp4b APN 8 81856744 missense probably damaging 1.00
IGL03146:Inpp4b APN 8 81743781 missense possibly damaging 0.61
LCD18:Inpp4b UTSW 8 81693010 intron probably benign
PIT4280001:Inpp4b UTSW 8 82034417 missense probably benign 0.00
PIT4480001:Inpp4b UTSW 8 82046267 missense probably damaging 1.00
PIT4504001:Inpp4b UTSW 8 82041935 missense probably damaging 1.00
R0083:Inpp4b UTSW 8 81741462 missense possibly damaging 0.77
R0212:Inpp4b UTSW 8 81770917 missense probably benign 0.00
R0285:Inpp4b UTSW 8 82034516 splice site probably benign
R0363:Inpp4b UTSW 8 81884257 splice site probably benign
R0364:Inpp4b UTSW 8 81997314 missense probably benign 0.09
R0471:Inpp4b UTSW 8 82041899 missense possibly damaging 0.94
R0550:Inpp4b UTSW 8 81997337 missense probably benign 0.00
R0562:Inpp4b UTSW 8 81768151 missense possibly damaging 0.88
R0661:Inpp4b UTSW 8 81741462 missense possibly damaging 0.77
R0693:Inpp4b UTSW 8 81997314 missense probably benign 0.09
R1081:Inpp4b UTSW 8 82069024 missense probably damaging 0.97
R1251:Inpp4b UTSW 8 81890753 missense probably benign 0.01
R1374:Inpp4b UTSW 8 81743816 critical splice donor site probably null
R1445:Inpp4b UTSW 8 81952834 intron probably null
R1465:Inpp4b UTSW 8 81768157 missense probably damaging 1.00
R1465:Inpp4b UTSW 8 81768157 missense probably damaging 1.00
R1647:Inpp4b UTSW 8 81856774 splice site probably benign
R1754:Inpp4b UTSW 8 81770811 missense probably damaging 1.00
R1759:Inpp4b UTSW 8 81768103 missense probably benign 0.06
R2085:Inpp4b UTSW 8 81952274 missense probably damaging 1.00
R2156:Inpp4b UTSW 8 82048489 missense probably damaging 1.00
R2160:Inpp4b UTSW 8 82121375 nonsense probably null
R2175:Inpp4b UTSW 8 81856699 missense probably damaging 1.00
R2191:Inpp4b UTSW 8 81997302 missense probably damaging 1.00
R2401:Inpp4b UTSW 8 81997339 missense probably benign 0.00
R2475:Inpp4b UTSW 8 82041978 missense probably benign 0.09
R2512:Inpp4b UTSW 8 82010550 missense probably damaging 1.00
R2919:Inpp4b UTSW 8 81985329 missense possibly damaging 0.93
R3021:Inpp4b UTSW 8 81902838 missense possibly damaging 0.47
R3423:Inpp4b UTSW 8 81952261 missense possibly damaging 0.63
R3777:Inpp4b UTSW 8 82041992 missense possibly damaging 0.89
R3778:Inpp4b UTSW 8 82041992 missense possibly damaging 0.89
R3794:Inpp4b UTSW 8 82033216 missense probably damaging 1.00
R3795:Inpp4b UTSW 8 82033216 missense probably damaging 1.00
R4590:Inpp4b UTSW 8 81741411 start codon destroyed probably null 1.00
R4602:Inpp4b UTSW 8 81969535 missense probably damaging 0.99
R4691:Inpp4b UTSW 8 82122653 missense probably damaging 1.00
R4924:Inpp4b UTSW 8 82122624 missense probably damaging 1.00
R4992:Inpp4b UTSW 8 82033208 missense probably damaging 1.00
R5219:Inpp4b UTSW 8 81884156 missense probably benign 0.01
R5228:Inpp4b UTSW 8 81768115 missense probably damaging 0.99
R5557:Inpp4b UTSW 8 81952259 missense probably damaging 0.99
R5627:Inpp4b UTSW 8 81743816 critical splice donor site probably benign
R5691:Inpp4b UTSW 8 81890694 intron probably benign
R6186:Inpp4b UTSW 8 82046234 missense probably damaging 0.99
R6213:Inpp4b UTSW 8 81997390 missense probably damaging 1.00
R6232:Inpp4b UTSW 8 81952184 missense probably damaging 1.00
R6283:Inpp4b UTSW 8 81770833 missense probably damaging 1.00
R6302:Inpp4b UTSW 8 81768177 missense probably benign 0.00
R6309:Inpp4b UTSW 8 82041917 missense probably damaging 1.00
R6360:Inpp4b UTSW 8 81902852 missense probably benign 0.20
R6477:Inpp4b UTSW 8 81844714 unclassified probably null
R6773:Inpp4b UTSW 8 81856620 intron probably benign
R6968:Inpp4b UTSW 8 81844457 missense probably benign 0.18
R7147:Inpp4b UTSW 8 81902771 missense probably damaging 1.00
R7409:Inpp4b UTSW 8 81952685 splice site probably null
R7455:Inpp4b UTSW 8 82071703 missense probably damaging 0.99
R7632:Inpp4b UTSW 8 82046339 missense probably damaging 1.00
RF003:Inpp4b UTSW 8 81969521 nonsense probably null
Z1088:Inpp4b UTSW 8 82068931 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGGTAGGGATCATTTCACTCAAAG -3'
(R):5'- TGCCTTAGGTGCATAGAGCC -3'

Sequencing Primer
(F):5'- TTTCACTCAAAGATATCAACCAGTC -3'
(R):5'- GGTGCATAGAGCCCTTTAACTCAG -3'
Posted On2019-06-26