Incidental Mutation 'R7318:Mylk3'
ID565655
Institutional Source Beutler Lab
Gene Symbol Mylk3
Ensembl Gene ENSMUSG00000031698
Gene Namemyosin light chain kinase 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.258) question?
Stock #R7318 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85324303-85386345 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85359097 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 269 (D269E)
Ref Sequence ENSEMBL: ENSMUSP00000034133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034133] [ENSMUST00000121972] [ENSMUST00000122452] [ENSMUST00000137290]
Predicted Effect probably benign
Transcript: ENSMUST00000034133
AA Change: D269E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034133
Gene: ENSMUSG00000031698
AA Change: D269E

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 304 316 N/A INTRINSIC
S_TKc 491 746 6.93e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121972
AA Change: D206E

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113960
Gene: ENSMUSG00000031698
AA Change: D206E

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
S_TKc 428 683 6.93e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122452
AA Change: D136E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113389
Gene: ENSMUSG00000031698
AA Change: D136E

DomainStartEndE-ValueType
low complexity region 171 183 N/A INTRINSIC
S_TKc 358 613 6.93e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137290
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylation of cardiac myosin heavy chains (see MYH7B, MIM 609928) and light chains (see MYL2, MIM 160781) by a kinase, such as MYLK3, potentiates the force and rate of cross-bridge recruitment in cardiac myocytes (Chan et al., 2008 [PubMed 18202317]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cardiac hypertrophy, reduced cardiac function and increased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,687 L260S probably benign Het
9130230L23Rik A T 5: 65,988,428 S113R unknown Het
Abcc5 G A 16: 20,392,543 P557S probably benign Het
Acad11 A G 9: 104,081,267 T245A probably damaging Het
Acap2 A G 16: 31,127,337 F263L probably damaging Het
Ankle2 A T 5: 110,237,766 N327I probably benign Het
Appl1 T C 14: 26,963,660 E67G probably benign Het
Arfgef3 A T 10: 18,630,463 C864S possibly damaging Het
Arhgap20 A G 9: 51,840,502 I418V probably benign Het
Arhgef2 A T 3: 88,632,303 N102Y probably damaging Het
Car9 G T 4: 43,513,089 E431D probably damaging Het
Cbfa2t2 T C 2: 154,500,454 I30T probably benign Het
Cd40 A T 2: 165,062,335 D34V possibly damaging Het
Chrnb2 T A 3: 89,763,367 probably null Het
Chsy1 T G 7: 66,110,229 probably null Het
Cpne6 A G 14: 55,514,294 T245A possibly damaging Het
Cpsf1 T A 15: 76,597,275 K1159* probably null Het
Crisp1 T A 17: 40,307,777 E64D possibly damaging Het
D3Ertd751e A G 3: 41,802,551 probably null Het
Dnah7b T A 1: 46,195,372 L1488Q probably damaging Het
Dnm2 G A 9: 21,505,567 G799R possibly damaging Het
E330009J07Rik A G 6: 40,409,164 V333A possibly damaging Het
Elp2 G A 18: 24,606,899 V61I probably damaging Het
Epb41l3 T C 17: 69,266,140 L388P Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fry A T 5: 150,436,993 S2035C probably damaging Het
Gas8 T C 8: 123,530,968 F385L probably benign Het
Ghsr T C 3: 27,372,467 V224A possibly damaging Het
Gstp2 T A 19: 4,041,065 R85W probably benign Het
Ighv1-20 T A 12: 114,724,190 I6F possibly damaging Het
Inpp4b T A 8: 82,071,745 M854K probably damaging Het
Kif15 A G 9: 122,987,949 E538G probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lmo3 T A 6: 138,421,365 probably benign Het
Lyg1 G A 1: 37,949,855 P95S probably benign Het
Lyst A G 13: 13,757,443 H3552R probably benign Het
Mtif2 C T 11: 29,540,115 S385L probably benign Het
Muc4 A T 16: 32,755,336 I1737F unknown Het
Mug1 T C 6: 121,870,652 probably null Het
Mx1 G T 16: 97,452,086 Q350K probably benign Het
Myo3a A T 2: 22,558,320 K974* probably null Het
Nectin4 G T 1: 171,380,463 R141L probably benign Het
Nlgn2 T C 11: 69,825,969 H582R probably damaging Het
Olfr558 T A 7: 102,710,019 Y253* probably null Het
Olfr613 T A 7: 103,552,091 M102K probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psmd11 C A 11: 80,456,302 L171I probably benign Het
Rad54l A G 4: 116,110,709 V152A possibly damaging Het
Ranbp2 T A 10: 58,483,087 Y2473* probably null Het
Sertad1 T C 7: 27,489,485 I77T possibly damaging Het
Sesn3 A T 9: 14,308,577 E87D probably damaging Het
Slc30a5 A T 13: 100,813,969 S260R probably benign Het
Slc6a12 G A 6: 121,352,013 G111S probably damaging Het
Slc6a12 T C 6: 121,352,019 Y113H probably benign Het
Spag17 T G 3: 99,939,983 M76R probably benign Het
Stard13 G A 5: 151,062,573 Q491* probably null Het
Synpo2 T C 3: 123,117,319 S226G probably benign Het
Tada2b G A 5: 36,483,987 T24I probably benign Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Tnnt1 T A 7: 4,510,548 probably null Het
Usp17lb T C 7: 104,841,133 I196V probably benign Het
Utp20 T A 10: 88,813,949 K466N possibly damaging Het
Wdr46 T C 17: 33,941,885 probably null Het
Zfp287 T A 11: 62,714,278 Q601L probably damaging Het
Zfp410 T C 12: 84,325,690 S97P probably benign Het
Other mutations in Mylk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Mylk3 APN 8 85355526 nonsense probably null
IGL01088:Mylk3 APN 8 85351957 splice site probably null
IGL01431:Mylk3 APN 8 85336401 missense probably damaging 1.00
IGL01488:Mylk3 APN 8 85352027 missense probably damaging 1.00
IGL01550:Mylk3 APN 8 85365089 missense probably damaging 1.00
IGL01786:Mylk3 APN 8 85359317 missense probably benign 0.27
IGL01877:Mylk3 APN 8 85359042 missense possibly damaging 0.66
IGL01995:Mylk3 APN 8 85359261 missense possibly damaging 0.83
IGL02003:Mylk3 APN 8 85359098 missense probably benign
IGL02251:Mylk3 APN 8 85355176 missense probably benign 0.04
IGL02252:Mylk3 APN 8 85355476 missense probably benign 0.04
IGL02341:Mylk3 APN 8 85351972 missense probably damaging 1.00
IGL02352:Mylk3 APN 8 85355302 missense probably benign 0.00
IGL02359:Mylk3 APN 8 85355302 missense probably benign 0.00
IGL03000:Mylk3 APN 8 85359177 missense probably damaging 0.97
IGL03185:Mylk3 APN 8 85327204 missense probably damaging 0.97
IGL03404:Mylk3 APN 8 85342681 missense probably damaging 1.00
R0005:Mylk3 UTSW 8 85327203 missense possibly damaging 0.93
R0219:Mylk3 UTSW 8 85355244 missense probably damaging 0.99
R0324:Mylk3 UTSW 8 85352906 missense probably damaging 0.98
R0402:Mylk3 UTSW 8 85352910 missense probably damaging 1.00
R0667:Mylk3 UTSW 8 85355165 critical splice donor site probably null
R1711:Mylk3 UTSW 8 85364831 missense probably damaging 1.00
R1857:Mylk3 UTSW 8 85328594 missense probably damaging 0.98
R1875:Mylk3 UTSW 8 85352865 missense probably damaging 1.00
R1878:Mylk3 UTSW 8 85355399 missense possibly damaging 0.82
R1916:Mylk3 UTSW 8 85327192 missense probably damaging 1.00
R3887:Mylk3 UTSW 8 85352047 missense probably damaging 1.00
R4081:Mylk3 UTSW 8 85328682 missense probably damaging 1.00
R4775:Mylk3 UTSW 8 85359060 nonsense probably null
R4796:Mylk3 UTSW 8 85350385 missense probably damaging 1.00
R4974:Mylk3 UTSW 8 85364783 missense probably damaging 0.97
R5108:Mylk3 UTSW 8 85359092 missense possibly damaging 0.83
R5194:Mylk3 UTSW 8 85352866 missense probably benign 0.26
R5276:Mylk3 UTSW 8 85355442 missense probably damaging 1.00
R5296:Mylk3 UTSW 8 85355431 missense possibly damaging 0.66
R5303:Mylk3 UTSW 8 85350476 missense probably damaging 1.00
R5338:Mylk3 UTSW 8 85342721 missense probably damaging 1.00
R5957:Mylk3 UTSW 8 85328637 missense probably damaging 0.98
R6021:Mylk3 UTSW 8 85364813 missense possibly damaging 0.92
R6294:Mylk3 UTSW 8 85350383 missense probably damaging 1.00
R6305:Mylk3 UTSW 8 85350419 missense probably damaging 1.00
R6376:Mylk3 UTSW 8 85358942 missense possibly damaging 0.53
R6970:Mylk3 UTSW 8 85359263 missense probably damaging 0.97
R7081:Mylk3 UTSW 8 85364793 missense probably benign 0.10
R7170:Mylk3 UTSW 8 85350485 missense probably damaging 1.00
R7422:Mylk3 UTSW 8 85355244 missense probably benign 0.16
R7503:Mylk3 UTSW 8 85353589 missense probably benign 0.00
R7536:Mylk3 UTSW 8 85353604 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTACCTGGGAAGTGCATCACC -3'
(R):5'- GGACATACCTGTGCGAACAGTG -3'

Sequencing Primer
(F):5'- GGAAGTGCATCACCACTGTG -3'
(R):5'- AGGGGCTGCCTCTCATCATC -3'
Posted On2019-06-26