Incidental Mutation 'R0584:Ptprr'
ID56566
Institutional Source Beutler Lab
Gene Symbol Ptprr
Ensembl Gene ENSMUSG00000020151
Gene Nameprotein tyrosine phosphatase, receptor type, R
SynonymsPTPBR7, PTP-SL, RPTPRR
MMRRC Submission 038774-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R0584 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116018213-116274932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116251158 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 270 (V270A)
Ref Sequence ENSEMBL: ENSMUSP00000122259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063470] [ENSMUST00000105271] [ENSMUST00000128399] [ENSMUST00000148731] [ENSMUST00000155606]
Predicted Effect probably damaging
Transcript: ENSMUST00000063470
AA Change: V514A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000064392
Gene: ENSMUSG00000020151
AA Change: V514A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
PTPc 391 648 3.74e-108 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105271
AA Change: V407A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100907
Gene: ENSMUSG00000020151
AA Change: V407A

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
PTPc 284 541 3.74e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128399
AA Change: V270A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114455
Gene: ENSMUSG00000020151
AA Change: V270A

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148731
AA Change: V270A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120965
Gene: ENSMUSG00000020151
AA Change: V270A

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155606
AA Change: V270A

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122259
Gene: ENSMUSG00000020151
AA Change: V270A

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Meta Mutation Damage Score 0.5564 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. Silencing of this gene has been associated with colorectal cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares a symbol (PTPRQ) with another gene, protein tyrosine phosphatase, receptor type, Q (GeneID 374462), which is also located on chromosome 12. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ERK1/2 phosphorylation levels in cerebellar Purkinje cells, decreased grip strength, and ataxia characterized by fine motor coordination and balance defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,011,730 S1745P probably damaging Het
Agfg2 G A 5: 137,667,730 T89I probably damaging Het
Agtr1a A G 13: 30,381,034 I27M probably damaging Het
Armh1 A T 4: 117,229,850 L206Q probably damaging Het
Asxl2 A T 12: 3,496,632 E472V probably damaging Het
Atp2c2 T A 8: 119,738,418 V313E probably benign Het
Casp12 A G 9: 5,352,268 I87V probably null Het
Ccl25 C T 8: 4,354,085 probably benign Het
Col9a1 T C 1: 24,224,490 probably benign Het
Cyth4 A G 15: 78,609,878 probably null Het
Dnah9 A G 11: 65,990,489 Y2587H probably damaging Het
Dppa3 T C 6: 122,629,992 I147T probably benign Het
Fam120b T C 17: 15,402,122 S121P probably damaging Het
Fam209 C T 2: 172,474,161 T152M probably benign Het
Fam98a A G 17: 75,544,777 L103P probably damaging Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fitm1 T C 14: 55,576,656 V203A probably benign Het
Gcn1l1 G A 5: 115,595,015 R1037Q probably damaging Het
Gm11563 A G 11: 99,658,625 I101T unknown Het
Gpd1l A G 9: 114,914,344 F163L probably damaging Het
Grp C A 18: 65,873,695 A30E possibly damaging Het
H1fnt C A 15: 98,257,077 E64* probably null Het
Icosl T C 10: 78,071,875 Y90H possibly damaging Het
Itsn2 A G 12: 4,697,180 T1194A probably benign Het
Lrp6 A G 6: 134,456,076 S1431P probably damaging Het
Ltbp1 T C 17: 75,363,472 S1503P probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Myh13 G T 11: 67,360,374 E1360* probably null Het
Nop58 A G 1: 59,706,760 D400G probably benign Het
Olfr507 T C 7: 108,622,415 L201P probably benign Het
Olfr775 T C 10: 129,250,948 V138A probably benign Het
Oscp1 A G 4: 126,083,594 probably null Het
Pde9a A T 17: 31,459,977 Y264F probably damaging Het
Pkhd1 T A 1: 20,239,436 K2763* probably null Het
Prkci T A 3: 31,025,140 C42* probably null Het
Rsf1 T A 7: 97,662,128 N688K possibly damaging Het
S1pr3 A T 13: 51,419,661 M293L probably benign Het
Scn10a A C 9: 119,670,531 L232R probably damaging Het
Sirt5 T A 13: 43,394,728 probably null Het
Sp6 C T 11: 97,022,265 T268M probably damaging Het
Spag5 A G 11: 78,304,095 N76S possibly damaging Het
Tecta T C 9: 42,347,908 N1560D possibly damaging Het
Togaram1 T C 12: 64,967,505 L510P probably damaging Het
Umps A G 16: 33,959,124 I401T probably damaging Het
Vars2 A G 17: 35,666,686 V118A possibly damaging Het
Other mutations in Ptprr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Ptprr APN 10 116188317 missense probably benign 0.00
IGL01762:Ptprr APN 10 116236733 missense probably damaging 1.00
IGL02429:Ptprr APN 10 116273767 missense probably damaging 0.99
IGL03396:Ptprr APN 10 116188330 missense probably damaging 1.00
R0268:Ptprr UTSW 10 116252963 missense possibly damaging 0.83
R1388:Ptprr UTSW 10 116273752 missense probably benign 0.14
R1438:Ptprr UTSW 10 116256204 missense probably damaging 0.98
R1533:Ptprr UTSW 10 116188208 nonsense probably null
R1654:Ptprr UTSW 10 116188363 missense probably benign 0.43
R1793:Ptprr UTSW 10 116252922 missense probably damaging 1.00
R4081:Ptprr UTSW 10 116236710 missense probably benign 0.01
R4193:Ptprr UTSW 10 116252864 missense probably damaging 1.00
R4254:Ptprr UTSW 10 116162443 splice site probably null
R4496:Ptprr UTSW 10 116229502 missense possibly damaging 0.91
R4799:Ptprr UTSW 10 116048218 missense probably benign 0.00
R5209:Ptprr UTSW 10 116162609 missense probably damaging 0.99
R5312:Ptprr UTSW 10 116188419 missense probably benign 0.28
R5410:Ptprr UTSW 10 116188330 missense possibly damaging 0.94
R5556:Ptprr UTSW 10 116251149 missense probably damaging 0.96
R5717:Ptprr UTSW 10 116048113 missense probably benign 0.11
R6039:Ptprr UTSW 10 116236763 splice site probably null
R6039:Ptprr UTSW 10 116236763 splice site probably null
R7013:Ptprr UTSW 10 116236754 missense probably damaging 1.00
R7401:Ptprr UTSW 10 116048236 missense probably benign
R7527:Ptprr UTSW 10 116251199 missense probably benign 0.08
R7644:Ptprr UTSW 10 116048228 missense probably benign 0.00
R7651:Ptprr UTSW 10 116251179 missense probably benign 0.01
R7708:Ptprr UTSW 10 116162597 missense probably benign 0.31
R7731:Ptprr UTSW 10 116237295 missense probably damaging 1.00
R8026:Ptprr UTSW 10 116048170 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTCTGGGGAAATTTTGCCTGTC -3'
(R):5'- TAAAGGTCCTGTCAGGTCTCCTGC -3'

Sequencing Primer
(F):5'- GGTCTGCACATCATAGAGTTCAC -3'
(R):5'- CTTCATAGGCTAATGGTGTCAGAC -3'
Posted On2013-07-11