Incidental Mutation 'R7318:Epb41l3'
ID565683
Institutional Source Beutler Lab
Gene Symbol Epb41l3
Ensembl Gene ENSMUSG00000024044
Gene Nameerythrocyte membrane protein band 4.1 like 3
SynonymsDAL1P, NBL3, Epb4.1l3, 4.1B
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7318 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location69075683-69289989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69266140 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 388 (L388P)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080208] [ENSMUST00000112680] [ENSMUST00000225740] [ENSMUST00000225977]
Predicted Effect probably benign
Transcript: ENSMUST00000080208
SMART Domains Protein: ENSMUSP00000079098
Gene: ENSMUSG00000024044

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
B41 114 309 1.13e-80 SMART
FERM_C 313 403 3.96e-38 SMART
FA 405 451 2.34e-17 SMART
low complexity region 497 517 N/A INTRINSIC
Pfam:SAB 556 604 2.1e-29 PFAM
low complexity region 789 802 N/A INTRINSIC
Pfam:4_1_CTD 809 922 1.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112680
SMART Domains Protein: ENSMUSP00000108300
Gene: ENSMUSG00000024044

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
low complexity region 94 107 N/A INTRINSIC
B41 114 309 1.13e-80 SMART
FERM_C 313 403 3.96e-38 SMART
FA 405 451 2.34e-17 SMART
low complexity region 497 517 N/A INTRINSIC
Pfam:SAB 566 614 3.2e-28 PFAM
low complexity region 799 812 N/A INTRINSIC
Pfam:4_1_CTD 825 931 2.9e-55 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000224523
Predicted Effect probably benign
Transcript: ENSMUST00000224951
Predicted Effect probably benign
Transcript: ENSMUST00000225740
Predicted Effect probably benign
Transcript: ENSMUST00000225977
Meta Mutation Damage Score 0.3618 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for one knock-out allele display a normal phenotype. Mice homozygous for a different knock-out allele exhibit ataxia, gait abnormalities, clasping, hypermyelination, abnormal axon morphology, and decreased internode length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,687 L260S probably benign Het
9130230L23Rik A T 5: 65,988,428 S113R unknown Het
Abcc5 G A 16: 20,392,543 P557S probably benign Het
Acad11 A G 9: 104,081,267 T245A probably damaging Het
Acap2 A G 16: 31,127,337 F263L probably damaging Het
Ankle2 A T 5: 110,237,766 N327I probably benign Het
Appl1 T C 14: 26,963,660 E67G probably benign Het
Arfgef3 A T 10: 18,630,463 C864S possibly damaging Het
Arhgap20 A G 9: 51,840,502 I418V probably benign Het
Arhgef2 A T 3: 88,632,303 N102Y probably damaging Het
Car9 G T 4: 43,513,089 E431D probably damaging Het
Cbfa2t2 T C 2: 154,500,454 I30T probably benign Het
Cd40 A T 2: 165,062,335 D34V possibly damaging Het
Chrnb2 T A 3: 89,763,367 probably null Het
Chsy1 T G 7: 66,110,229 probably null Het
Cpne6 A G 14: 55,514,294 T245A possibly damaging Het
Cpsf1 T A 15: 76,597,275 K1159* probably null Het
Crisp1 T A 17: 40,307,777 E64D possibly damaging Het
D3Ertd751e A G 3: 41,802,551 probably null Het
Dnah7b T A 1: 46,195,372 L1488Q probably damaging Het
Dnm2 G A 9: 21,505,567 G799R possibly damaging Het
E330009J07Rik A G 6: 40,409,164 V333A possibly damaging Het
Elp2 G A 18: 24,606,899 V61I probably damaging Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fry A T 5: 150,436,993 S2035C probably damaging Het
Gas8 T C 8: 123,530,968 F385L probably benign Het
Ghsr T C 3: 27,372,467 V224A possibly damaging Het
Gstp2 T A 19: 4,041,065 R85W probably benign Het
Ighv1-20 T A 12: 114,724,190 I6F possibly damaging Het
Inpp4b T A 8: 82,071,745 M854K probably damaging Het
Kif15 A G 9: 122,987,949 E538G probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lmo3 T A 6: 138,421,365 probably benign Het
Lyg1 G A 1: 37,949,855 P95S probably benign Het
Lyst A G 13: 13,757,443 H3552R probably benign Het
Mtif2 C T 11: 29,540,115 S385L probably benign Het
Muc4 A T 16: 32,755,336 I1737F unknown Het
Mug1 T C 6: 121,870,652 probably null Het
Mx1 G T 16: 97,452,086 Q350K probably benign Het
Mylk3 G T 8: 85,359,097 D269E probably benign Het
Myo3a A T 2: 22,558,320 K974* probably null Het
Nectin4 G T 1: 171,380,463 R141L probably benign Het
Nlgn2 T C 11: 69,825,969 H582R probably damaging Het
Olfr558 T A 7: 102,710,019 Y253* probably null Het
Olfr613 T A 7: 103,552,091 M102K probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psmd11 C A 11: 80,456,302 L171I probably benign Het
Rad54l A G 4: 116,110,709 V152A possibly damaging Het
Ranbp2 T A 10: 58,483,087 Y2473* probably null Het
Sertad1 T C 7: 27,489,485 I77T possibly damaging Het
Sesn3 A T 9: 14,308,577 E87D probably damaging Het
Slc30a5 A T 13: 100,813,969 S260R probably benign Het
Slc6a12 G A 6: 121,352,013 G111S probably damaging Het
Slc6a12 T C 6: 121,352,019 Y113H probably benign Het
Spag17 T G 3: 99,939,983 M76R probably benign Het
Stard13 G A 5: 151,062,573 Q491* probably null Het
Synpo2 T C 3: 123,117,319 S226G probably benign Het
Tada2b G A 5: 36,483,987 T24I probably benign Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Tnnt1 T A 7: 4,510,548 probably null Het
Usp17lb T C 7: 104,841,133 I196V probably benign Het
Utp20 T A 10: 88,813,949 K466N possibly damaging Het
Wdr46 T C 17: 33,941,885 probably null Het
Zfp287 T A 11: 62,714,278 Q601L probably damaging Het
Zfp410 T C 12: 84,325,690 S97P probably benign Het
Other mutations in Epb41l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Epb41l3 APN 17 69207861 splice site probably benign
IGL01099:Epb41l3 APN 17 69210193 missense possibly damaging 0.80
IGL01578:Epb41l3 APN 17 69248709 missense probably damaging 1.00
IGL02269:Epb41l3 APN 17 69247573 missense probably damaging 1.00
IGL02926:Epb41l3 APN 17 69247746 missense probably damaging 1.00
IGL03397:Epb41l3 APN 17 69248692 missense probably damaging 1.00
E0370:Epb41l3 UTSW 17 69274804 missense possibly damaging 0.73
P0031:Epb41l3 UTSW 17 69259054 nonsense probably null
R0032:Epb41l3 UTSW 17 69210384 critical splice donor site probably null
R0056:Epb41l3 UTSW 17 69253397 missense probably damaging 1.00
R0092:Epb41l3 UTSW 17 69286750 missense probably damaging 1.00
R0499:Epb41l3 UTSW 17 69247659 missense probably benign 0.00
R0560:Epb41l3 UTSW 17 69274897 critical splice donor site probably null
R1164:Epb41l3 UTSW 17 69274767 missense possibly damaging 0.93
R1170:Epb41l3 UTSW 17 69259180 nonsense probably null
R1397:Epb41l3 UTSW 17 69262348 critical splice donor site probably null
R2080:Epb41l3 UTSW 17 69253468 missense possibly damaging 0.54
R2138:Epb41l3 UTSW 17 69207880 missense probably damaging 1.00
R2279:Epb41l3 UTSW 17 69270650 missense possibly damaging 0.56
R2863:Epb41l3 UTSW 17 69210321 missense probably benign 0.22
R3883:Epb41l3 UTSW 17 69274116 nonsense probably null
R3884:Epb41l3 UTSW 17 69274116 nonsense probably null
R4165:Epb41l3 UTSW 17 69207888 missense probably damaging 1.00
R4795:Epb41l3 UTSW 17 69248719 critical splice donor site probably null
R5286:Epb41l3 UTSW 17 69262273 missense probably benign 0.00
R5303:Epb41l3 UTSW 17 69257449 missense probably damaging 1.00
R5373:Epb41l3 UTSW 17 69286800 missense probably damaging 1.00
R5374:Epb41l3 UTSW 17 69286800 missense probably damaging 1.00
R5938:Epb41l3 UTSW 17 69259071 missense probably damaging 1.00
R6014:Epb41l3 UTSW 17 69283960 missense probably damaging 0.98
R6059:Epb41l3 UTSW 17 69284642 missense probably damaging 1.00
R6059:Epb41l3 UTSW 17 69286798 missense probably damaging 1.00
R7548:Epb41l3 UTSW 17 69210276 missense probably damaging 1.00
R7719:Epb41l3 UTSW 17 69253414 missense possibly damaging 0.81
R7769:Epb41l3 UTSW 17 69238426 missense probably damaging 0.98
X0066:Epb41l3 UTSW 17 69259158 nonsense probably null
Z1088:Epb41l3 UTSW 17 69253522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCGCTGCTGACTCATG -3'
(R):5'- TCCAGGTAGCAGAGGCACAG -3'

Sequencing Primer
(F):5'- GCTGACTCATGTCCCCCATCAC -3'
(R):5'- AGAGTGAGGGCGTATGGTACTG -3'
Posted On2019-06-26