Incidental Mutation 'R7318:Gstp2'
ID565685
Institutional Source Beutler Lab
Gene Symbol Gstp2
Ensembl Gene ENSMUSG00000038155
Gene Nameglutathione S-transferase, pi 2
SynonymsGst p-2, GSTpiA, Gst3, Gst-3
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R7318 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4040285-4042236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4041065 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 85 (R85W)
Ref Sequence ENSEMBL: ENSMUSP00000038931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042700] [ENSMUST00000169613]
Predicted Effect probably benign
Transcript: ENSMUST00000042700
AA Change: R85W

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038931
Gene: ENSMUSG00000038155
AA Change: R85W

DomainStartEndE-ValueType
Pfam:GST_N 2 75 4.2e-8 PFAM
Pfam:GST_C 97 188 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169613
SMART Domains Protein: ENSMUSP00000129565
Gene: ENSMUSG00000060803

DomainStartEndE-ValueType
Pfam:GST_N 4 75 2.3e-8 PFAM
Pfam:GST_C 97 188 1.5e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mutant mice with null mutations in both Gstp1 and Gstp2 exhibit an increased susceptibility to DMBA and TPA induced skin papillomas. Male mutant mice exhibit an increased body weight with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik T C 7: 40,993,687 L260S probably benign Het
9130230L23Rik A T 5: 65,988,428 S113R unknown Het
Abcc5 G A 16: 20,392,543 P557S probably benign Het
Acad11 A G 9: 104,081,267 T245A probably damaging Het
Acap2 A G 16: 31,127,337 F263L probably damaging Het
Ankle2 A T 5: 110,237,766 N327I probably benign Het
Appl1 T C 14: 26,963,660 E67G probably benign Het
Arfgef3 A T 10: 18,630,463 C864S possibly damaging Het
Arhgap20 A G 9: 51,840,502 I418V probably benign Het
Arhgef2 A T 3: 88,632,303 N102Y probably damaging Het
Car9 G T 4: 43,513,089 E431D probably damaging Het
Cbfa2t2 T C 2: 154,500,454 I30T probably benign Het
Cd40 A T 2: 165,062,335 D34V possibly damaging Het
Chrnb2 T A 3: 89,763,367 probably null Het
Chsy1 T G 7: 66,110,229 probably null Het
Cpne6 A G 14: 55,514,294 T245A possibly damaging Het
Cpsf1 T A 15: 76,597,275 K1159* probably null Het
Crisp1 T A 17: 40,307,777 E64D possibly damaging Het
D3Ertd751e A G 3: 41,802,551 probably null Het
Dnah7b T A 1: 46,195,372 L1488Q probably damaging Het
Dnm2 G A 9: 21,505,567 G799R possibly damaging Het
E330009J07Rik A G 6: 40,409,164 V333A possibly damaging Het
Elp2 G A 18: 24,606,899 V61I probably damaging Het
Epb41l3 T C 17: 69,266,140 L388P Het
Fam19a1 T C 6: 96,115,756 probably null Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fry A T 5: 150,436,993 S2035C probably damaging Het
Gas8 T C 8: 123,530,968 F385L probably benign Het
Ghsr T C 3: 27,372,467 V224A possibly damaging Het
Ighv1-20 T A 12: 114,724,190 I6F possibly damaging Het
Inpp4b T A 8: 82,071,745 M854K probably damaging Het
Kif15 A G 9: 122,987,949 E538G probably damaging Het
Large2 T C 2: 92,366,028 T485A probably benign Het
Lmo3 T A 6: 138,421,365 probably benign Het
Lyg1 G A 1: 37,949,855 P95S probably benign Het
Lyst A G 13: 13,757,443 H3552R probably benign Het
Mtif2 C T 11: 29,540,115 S385L probably benign Het
Muc4 A T 16: 32,755,336 I1737F unknown Het
Mug1 T C 6: 121,870,652 probably null Het
Mx1 G T 16: 97,452,086 Q350K probably benign Het
Mylk3 G T 8: 85,359,097 D269E probably benign Het
Myo3a A T 2: 22,558,320 K974* probably null Het
Nectin4 G T 1: 171,380,463 R141L probably benign Het
Nlgn2 T C 11: 69,825,969 H582R probably damaging Het
Olfr558 T A 7: 102,710,019 Y253* probably null Het
Olfr613 T A 7: 103,552,091 M102K probably damaging Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Psmd11 C A 11: 80,456,302 L171I probably benign Het
Rad54l A G 4: 116,110,709 V152A possibly damaging Het
Ranbp2 T A 10: 58,483,087 Y2473* probably null Het
Sertad1 T C 7: 27,489,485 I77T possibly damaging Het
Sesn3 A T 9: 14,308,577 E87D probably damaging Het
Slc30a5 A T 13: 100,813,969 S260R probably benign Het
Slc6a12 G A 6: 121,352,013 G111S probably damaging Het
Slc6a12 T C 6: 121,352,019 Y113H probably benign Het
Spag17 T G 3: 99,939,983 M76R probably benign Het
Stard13 G A 5: 151,062,573 Q491* probably null Het
Synpo2 T C 3: 123,117,319 S226G probably benign Het
Tada2b G A 5: 36,483,987 T24I probably benign Het
Tmem51 TCCCC TCCC 4: 142,037,685 probably null Het
Tnnt1 T A 7: 4,510,548 probably null Het
Usp17lb T C 7: 104,841,133 I196V probably benign Het
Utp20 T A 10: 88,813,949 K466N possibly damaging Het
Wdr46 T C 17: 33,941,885 probably null Het
Zfp287 T A 11: 62,714,278 Q601L probably damaging Het
Zfp410 T C 12: 84,325,690 S97P probably benign Het
Other mutations in Gstp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02387:Gstp2 APN 19 4041094 unclassified probably benign
PIT4362001:Gstp2 UTSW 19 4040713 missense possibly damaging 0.82
R0196:Gstp2 UTSW 19 4040514 unclassified probably null
R0545:Gstp2 UTSW 19 4041633 missense possibly damaging 0.88
R6324:Gstp2 UTSW 19 4040499 missense probably benign 0.00
R6478:Gstp2 UTSW 19 4040499 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATGTACCATCCTCCCACTG -3'
(R):5'- TTCAGGCTGCATCTGTGGTC -3'

Sequencing Primer
(F):5'- GCTGCCCTGTAATGAATTCCAG -3'
(R):5'- ATCTGTGGTCTGCCTGCCATG -3'
Posted On2019-06-26