Incidental Mutation 'R7282:Lgsn'
ID565686
Institutional Source Beutler Lab
Gene Symbol Lgsn
Ensembl Gene ENSMUSG00000050217
Gene Namelengsin, lens protein with glutamine synthetase domain
Synonymslengsin, Lgs, Gluld1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R7282 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location31176401-31204725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 31203371 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 178 (L178R)
Ref Sequence ENSEMBL: ENSMUSP00000059871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062560] [ENSMUST00000127775] [ENSMUST00000135245] [ENSMUST00000187659]
PDB Structure
Lengsin is a survivor of an ancient family of class I glutamine synthetases in eukaryotes that has undergone evolutionary re- engineering for a tissue-specific role in the vertebrate eye lens. [ELECTRON MICROSCOPY]
Predicted Effect probably damaging
Transcript: ENSMUST00000062560
AA Change: L178R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059871
Gene: ENSMUSG00000050217
AA Change: L178R

DomainStartEndE-ValueType
SCOP:d1f52a1 128 233 2e-20 SMART
Gln-synt_C 235 481 1.67e-39 SMART
low complexity region 483 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127775
SMART Domains Protein: ENSMUSP00000120381
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000135245
SMART Domains Protein: ENSMUSP00000120289
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000161773
Predicted Effect probably benign
Transcript: ENSMUST00000187659
SMART Domains Protein: ENSMUSP00000139710
Gene: ENSMUSG00000086727

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187892
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the GS I members of the glutamine synthetase superfamily. The encoded protein is referred to as a pseudo-glutamine synthetase because it has no glutamine synthesis activity and may function as a chaperone protein. This protein is localized to the lens and may be associated with cataract disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,425,756 D187E probably damaging Het
9530053A07Rik A G 7: 28,144,408 N907S probably benign Het
A830010M20Rik G T 5: 107,507,196 V954L probably benign Het
A830010M20Rik A G 5: 107,510,505 D1647G probably damaging Het
Abl2 T C 1: 156,630,060 Y299H probably damaging Het
Acsl3 T A 1: 78,681,992 N120K probably damaging Het
Aldh1a1 A G 19: 20,629,070 K255R possibly damaging Het
Baz2b C T 2: 59,920,437 R1205H probably benign Het
Carmil1 A G 13: 24,013,404 S1350P probably benign Het
Cecr2 A T 6: 120,761,621 N325I Het
Cep120 C T 18: 53,740,089 A57T probably damaging Het
Chst8 T C 7: 34,748,203 probably null Het
Cntn4 A T 6: 106,525,460 I393F probably damaging Het
Crocc T C 4: 141,022,341 D1494G probably damaging Het
Cwc25 T C 11: 97,748,006 E364G possibly damaging Het
Dnah7a C A 1: 53,684,900 probably null Het
Drg2 A G 11: 60,454,693 E5G probably benign Het
Ehd4 T C 2: 120,091,248 H509R probably damaging Het
Enam A T 5: 88,502,327 N565I probably damaging Het
Evi2a G T 11: 79,527,423 N120K probably benign Het
Faim A G 9: 98,992,126 T2A probably benign Het
Fmnl1 T C 11: 103,196,265 V836A unknown Het
Fosb T C 7: 19,305,188 I224V possibly damaging Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gm13103 A G 4: 143,851,881 N237S possibly damaging Het
Gm9972 G A 11: 43,036,804 G93R unknown Het
Gtf2a1 A T 12: 91,567,835 I215N possibly damaging Het
Hs3st3b1 A G 11: 63,921,571 V106A probably benign Het
Igkv19-93 T C 6: 68,736,501 D48G probably benign Het
Itgb8 A T 12: 119,237,708 W31R probably benign Het
Kmt2d A T 15: 98,854,104 W1995R unknown Het
Lama3 G T 18: 12,439,392 Q551H probably damaging Het
Lama5 T C 2: 180,201,795 Y453C probably damaging Het
Lbhd2 G A 12: 111,410,290 R57H probably damaging Het
Lcmt2 A G 2: 121,138,790 V384A probably damaging Het
Lhcgr C T 17: 88,758,383 V193I probably benign Het
Lta4h T C 10: 93,453,511 M1T probably null Het
Ly6l T C 15: 75,449,496 S14P probably damaging Het
Met C A 6: 17,547,012 C881* probably null Het
Mettl21e A T 1: 44,210,239 Y86N probably damaging Het
Mgam A T 6: 40,656,512 N251Y possibly damaging Het
Mgam A G 6: 40,763,111 T1673A probably benign Het
Mmp27 T A 9: 7,578,230 V357D probably damaging Het
Muc2 A G 7: 141,752,744 E740G Het
Myoc C A 1: 162,648,844 S372R probably benign Het
Ncor2 A T 5: 125,020,040 M1358K Het
Nol6 A G 4: 41,119,468 S613P probably benign Het
Nuggc T A 14: 65,617,623 I334N probably damaging Het
Nxnl2 C T 13: 51,171,506 P62S probably damaging Het
Ogfod1 C T 8: 94,037,439 H51Y possibly damaging Het
Olfml1 T A 7: 107,590,323 D198E possibly damaging Het
Olfr1395 A C 11: 49,149,118 N287T probably damaging Het
Ovch2 C T 7: 107,794,370 R183H possibly damaging Het
Plxnd1 A T 6: 115,960,837 L1516Q probably damaging Het
Prrc2c A G 1: 162,679,974 V2448A possibly damaging Het
Rexo5 C T 7: 119,818,413 T212I probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rnf213 T G 11: 119,437,992 I2030S Het
Rtf1 C T 2: 119,675,099 A11V unknown Het
Setdb1 T G 3: 95,338,674 T647P probably damaging Het
Shisa6 G C 11: 66,502,654 P272R possibly damaging Het
Slc25a54 G T 3: 109,116,501 G471* probably null Het
Slc30a1 A G 1: 191,909,432 T397A probably benign Het
Slc7a14 A G 3: 31,227,153 F336S possibly damaging Het
Slitrk3 C T 3: 73,050,465 V325I possibly damaging Het
Sptan1 A G 2: 29,986,929 Y361C probably damaging Het
Stard9 A G 2: 120,698,503 D1747G probably benign Het
Taf3 T C 2: 9,951,442 E638G probably damaging Het
Tbc1d8 T C 1: 39,372,533 D1074G probably benign Het
Tecrl G A 5: 83,354,907 H32Y probably benign Het
Tgm3 T A 2: 130,024,561 M133K probably benign Het
Tmem131 A G 1: 36,841,604 F195S probably damaging Het
Tmem82 T C 4: 141,614,950 I314V possibly damaging Het
Trappc10 T C 10: 78,207,493 E555G probably damaging Het
Ubn2 A T 6: 38,452,876 K176* probably null Het
Ucp1 G A 8: 83,293,902 G114R probably benign Het
Unc5c A G 3: 141,677,990 D43G probably damaging Het
Vmn2r3 C T 3: 64,261,404 V571M possibly damaging Het
Vwa3a A T 7: 120,786,465 I677L probably benign Het
Wdr48 T C 9: 119,911,081 S319P probably damaging Het
Other mutations in Lgsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Lgsn APN 1 31203566 missense possibly damaging 0.75
IGL01347:Lgsn APN 1 31203960 missense probably damaging 1.00
IGL01688:Lgsn APN 1 31204405 missense probably damaging 1.00
IGL02937:Lgsn APN 1 31204237 missense possibly damaging 0.63
IGL03056:Lgsn APN 1 31203624 nonsense probably null
R0026:Lgsn UTSW 1 31203443 missense probably damaging 0.99
R0026:Lgsn UTSW 1 31203443 missense probably damaging 0.99
R0042:Lgsn UTSW 1 31190453 missense probably benign
R0042:Lgsn UTSW 1 31190453 missense probably benign
R0611:Lgsn UTSW 1 31203655 missense probably benign 0.01
R0905:Lgsn UTSW 1 31203743 missense probably damaging 0.99
R2248:Lgsn UTSW 1 31203526 missense possibly damaging 0.71
R3883:Lgsn UTSW 1 31176459 missense probably benign 0.00
R4782:Lgsn UTSW 1 31203742 missense probably benign 0.44
R5560:Lgsn UTSW 1 31196872 missense probably damaging 1.00
R6011:Lgsn UTSW 1 31203766 missense probably damaging 1.00
R6998:Lgsn UTSW 1 31204193 missense probably benign 0.20
R7003:Lgsn UTSW 1 31203943 missense possibly damaging 0.46
R7007:Lgsn UTSW 1 31190427 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGACAGTTAATGCTAACTCACAG -3'
(R):5'- GAATTGATCACTTCGGGCACAC -3'

Sequencing Primer
(F):5'- TGCTAACTCACAGATATTACACTTCC -3'
(R):5'- CCTCTTGGCGATGTACCTAGG -3'
Posted On2019-06-26