Incidental Mutation 'R0584:Myh13'
ID56569
Institutional Source Beutler Lab
Gene Symbol Myh13
Ensembl Gene ENSMUSG00000060180
Gene Namemyosin, heavy polypeptide 13, skeletal muscle
SynonymsEO Myosin, extraocular myosin, MyHC-eo
MMRRC Submission 038774-MU
Accession Numbers

Genbank: NM_001081250; MGI: 1339967

Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R0584 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67321658-67371586 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 67360374 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1360 (E1360*)
Ref Sequence ENSEMBL: ENSMUSP00000137731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081911] [ENSMUST00000108684] [ENSMUST00000180845]
Predicted Effect probably null
Transcript: ENSMUST00000081911
AA Change: E1360*
SMART Domains Protein: ENSMUSP00000080584
Gene: ENSMUSG00000060180
AA Change: E1360*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 8e-13 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
Pfam:Myosin_tail_1 847 1928 4.6e-159 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108684
AA Change: E1360*
SMART Domains Protein: ENSMUSP00000104324
Gene: ENSMUSG00000060180
AA Change: E1360*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122618
Predicted Effect probably null
Transcript: ENSMUST00000180845
AA Change: E1360*
SMART Domains Protein: ENSMUSP00000137731
Gene: ENSMUSG00000060180
AA Change: E1360*

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.8e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 4.6e-1 SMART
low complexity region 847 858 N/A INTRINSIC
low complexity region 925 940 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181027
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,011,730 S1745P probably damaging Het
Agfg2 G A 5: 137,667,730 T89I probably damaging Het
Agtr1a A G 13: 30,381,034 I27M probably damaging Het
Armh1 A T 4: 117,229,850 L206Q probably damaging Het
Asxl2 A T 12: 3,496,632 E472V probably damaging Het
Atp2c2 T A 8: 119,738,418 V313E probably benign Het
Casp12 A G 9: 5,352,268 I87V probably null Het
Ccl25 C T 8: 4,354,085 probably benign Het
Col9a1 T C 1: 24,224,490 probably benign Het
Cyth4 A G 15: 78,609,878 probably null Het
Dnah9 A G 11: 65,990,489 Y2587H probably damaging Het
Dppa3 T C 6: 122,629,992 I147T probably benign Het
Fam120b T C 17: 15,402,122 S121P probably damaging Het
Fam209 C T 2: 172,474,161 T152M probably benign Het
Fam98a A G 17: 75,544,777 L103P probably damaging Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fitm1 T C 14: 55,576,656 V203A probably benign Het
Gcn1l1 G A 5: 115,595,015 R1037Q probably damaging Het
Gm11563 A G 11: 99,658,625 I101T unknown Het
Gpd1l A G 9: 114,914,344 F163L probably damaging Het
Grp C A 18: 65,873,695 A30E possibly damaging Het
H1fnt C A 15: 98,257,077 E64* probably null Het
Icosl T C 10: 78,071,875 Y90H possibly damaging Het
Itsn2 A G 12: 4,697,180 T1194A probably benign Het
Lrp6 A G 6: 134,456,076 S1431P probably damaging Het
Ltbp1 T C 17: 75,363,472 S1503P probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Nop58 A G 1: 59,706,760 D400G probably benign Het
Olfr507 T C 7: 108,622,415 L201P probably benign Het
Olfr775 T C 10: 129,250,948 V138A probably benign Het
Oscp1 A G 4: 126,083,594 probably null Het
Pde9a A T 17: 31,459,977 Y264F probably damaging Het
Pkhd1 T A 1: 20,239,436 K2763* probably null Het
Prkci T A 3: 31,025,140 C42* probably null Het
Ptprr T C 10: 116,251,158 V270A probably damaging Het
Rsf1 T A 7: 97,662,128 N688K possibly damaging Het
S1pr3 A T 13: 51,419,661 M293L probably benign Het
Scn10a A C 9: 119,670,531 L232R probably damaging Het
Sirt5 T A 13: 43,394,728 probably null Het
Sp6 C T 11: 97,022,265 T268M probably damaging Het
Spag5 A G 11: 78,304,095 N76S possibly damaging Het
Tecta T C 9: 42,347,908 N1560D possibly damaging Het
Togaram1 T C 12: 64,967,505 L510P probably damaging Het
Umps A G 16: 33,959,124 I401T probably damaging Het
Vars2 A G 17: 35,666,686 V118A possibly damaging Het
Other mutations in Myh13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Myh13 APN 11 67342488 missense probably damaging 1.00
IGL00808:Myh13 APN 11 67335004 critical splice donor site probably null
IGL00822:Myh13 APN 11 67361328 missense probably damaging 0.98
IGL00823:Myh13 APN 11 67355947 missense probably benign 0.00
IGL00945:Myh13 APN 11 67348006 missense probably null 1.00
IGL01414:Myh13 APN 11 67342472 missense probably benign 0.02
IGL01482:Myh13 APN 11 67352068 missense probably benign
IGL01523:Myh13 APN 11 67347943 missense possibly damaging 0.73
IGL01723:Myh13 APN 11 67369219 unclassified probably benign
IGL01997:Myh13 APN 11 67367166 missense probably benign 0.14
IGL02369:Myh13 APN 11 67360274 unclassified probably benign
IGL02478:Myh13 APN 11 67369378 missense probably benign
IGL02663:Myh13 APN 11 67354927 nonsense probably null
IGL02851:Myh13 APN 11 67348916 missense possibly damaging 0.92
IGL02863:Myh13 APN 11 67332541 missense probably damaging 1.00
IGL02929:Myh13 APN 11 67367165 missense probably damaging 1.00
IGL02979:Myh13 APN 11 67334962 missense possibly damaging 0.72
IGL03065:Myh13 APN 11 67344853 missense probably damaging 0.99
IGL03214:Myh13 APN 11 67353585 missense possibly damaging 0.79
IGL03223:Myh13 APN 11 67350242 missense probably benign 0.39
IGL03231:Myh13 APN 11 67351991 missense possibly damaging 0.94
IGL03407:Myh13 APN 11 67352152 missense probably damaging 1.00
3-1:Myh13 UTSW 11 67351951 splice site probably benign
P0042:Myh13 UTSW 11 67334991 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0047:Myh13 UTSW 11 67367237 missense probably benign 0.00
R0379:Myh13 UTSW 11 67369295 unclassified probably benign
R0496:Myh13 UTSW 11 67348815 missense probably damaging 1.00
R0595:Myh13 UTSW 11 67344846 missense probably benign 0.03
R0621:Myh13 UTSW 11 67341232 missense probably damaging 0.98
R0834:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R0893:Myh13 UTSW 11 67334601 missense probably damaging 1.00
R0964:Myh13 UTSW 11 67345002 missense probably benign 0.02
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0973:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R0974:Myh13 UTSW 11 67332520 missense probably damaging 1.00
R1028:Myh13 UTSW 11 67356181 missense possibly damaging 0.71
R1112:Myh13 UTSW 11 67354750 missense probably damaging 1.00
R1283:Myh13 UTSW 11 67370921 missense probably damaging 1.00
R1288:Myh13 UTSW 11 67353718 missense probably benign 0.00
R1386:Myh13 UTSW 11 67370950 missense possibly damaging 0.79
R1457:Myh13 UTSW 11 67331046 missense probably damaging 0.97
R1503:Myh13 UTSW 11 67353674 missense probably benign 0.43
R1574:Myh13 UTSW 11 67362581 unclassified probably benign
R1673:Myh13 UTSW 11 67352119 missense possibly damaging 0.79
R1693:Myh13 UTSW 11 67341484 missense possibly damaging 0.95
R1763:Myh13 UTSW 11 67334576 missense probably benign
R2029:Myh13 UTSW 11 67361289 missense probably benign 0.03
R2030:Myh13 UTSW 11 67350238 missense probably benign
R2247:Myh13 UTSW 11 67334558 missense probably damaging 0.96
R2393:Myh13 UTSW 11 67340358 missense possibly damaging 0.93
R2395:Myh13 UTSW 11 67364922 missense probably benign 0.12
R2884:Myh13 UTSW 11 67337643 missense probably benign 0.27
R3696:Myh13 UTSW 11 67345044 missense possibly damaging 0.55
R3786:Myh13 UTSW 11 67327188 missense probably benign 0.01
R3875:Myh13 UTSW 11 67358194 missense probably benign 0.26
R3918:Myh13 UTSW 11 67329238 missense probably benign 0.00
R4061:Myh13 UTSW 11 67330889 missense possibly damaging 0.71
R4160:Myh13 UTSW 11 67364810 intron probably benign
R4183:Myh13 UTSW 11 67349610 missense possibly damaging 0.88
R4392:Myh13 UTSW 11 67344881 splice site probably null
R4639:Myh13 UTSW 11 67341551 missense possibly damaging 0.91
R4670:Myh13 UTSW 11 67364738 nonsense probably null
R4783:Myh13 UTSW 11 67341270 missense probably damaging 1.00
R4877:Myh13 UTSW 11 67337651 missense probably damaging 0.99
R5250:Myh13 UTSW 11 67327259 nonsense probably null
R5278:Myh13 UTSW 11 67334564 missense probably benign 0.00
R5371:Myh13 UTSW 11 67344790 splice site probably null
R5479:Myh13 UTSW 11 67348822 missense probably damaging 0.97
R5510:Myh13 UTSW 11 67337723 missense probably benign 0.05
R5690:Myh13 UTSW 11 67329275 missense probably damaging 1.00
R5797:Myh13 UTSW 11 67335002 missense possibly damaging 0.66
R5823:Myh13 UTSW 11 67360468 missense probably damaging 1.00
R5877:Myh13 UTSW 11 67353658 missense possibly damaging 0.78
R6041:Myh13 UTSW 11 67364730 missense probably damaging 1.00
R6175:Myh13 UTSW 11 67354762 missense probably benign 0.00
R6244:Myh13 UTSW 11 67362501 missense probably benign 0.00
R6454:Myh13 UTSW 11 67350365 missense probably benign 0.03
R6617:Myh13 UTSW 11 67361400 missense probably benign 0.00
R6707:Myh13 UTSW 11 67350260 missense probably damaging 1.00
R6747:Myh13 UTSW 11 67350419 missense probably damaging 0.99
R6823:Myh13 UTSW 11 67356158 missense probably benign
R6911:Myh13 UTSW 11 67354927 nonsense probably null
R6997:Myh13 UTSW 11 67327154 nonsense probably null
R7033:Myh13 UTSW 11 67369316 missense possibly damaging 0.92
R7145:Myh13 UTSW 11 67354740 missense probably benign 0.08
R7232:Myh13 UTSW 11 67348846 missense probably damaging 1.00
R7428:Myh13 UTSW 11 67332564 missense probably damaging 1.00
R7448:Myh13 UTSW 11 67364460 critical splice acceptor site probably null
R7474:Myh13 UTSW 11 67327164 missense possibly damaging 0.93
R7474:Myh13 UTSW 11 67367711 missense
R7766:Myh13 UTSW 11 67358329 missense probably benign 0.37
R7809:Myh13 UTSW 11 67350341 missense probably benign 0.14
R7813:Myh13 UTSW 11 67327230 missense probably benign 0.27
R7953:Myh13 UTSW 11 67340380 missense probably damaging 1.00
R8085:Myh13 UTSW 11 67334787 missense probably benign 0.00
R8397:Myh13 UTSW 11 67350287 missense possibly damaging 0.62
R8434:Myh13 UTSW 11 67363185 critical splice acceptor site probably null
R8490:Myh13 UTSW 11 67364525 missense probably damaging 0.98
R8676:Myh13 UTSW 11 67342485 missense probably damaging 1.00
R8681:Myh13 UTSW 11 67352134 missense possibly damaging 0.49
R8777:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
R8777-TAIL:Myh13 UTSW 11 67361335 missense possibly damaging 0.92
Z1176:Myh13 UTSW 11 67329295 missense possibly damaging 0.93
Z1177:Myh13 UTSW 11 67350452 missense possibly damaging 0.55
Z1177:Myh13 UTSW 11 67364591 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATCTTCACTGGGAAGAGGTCCATGT -3'
(R):5'- TGGAGGACTGCTCTCATACCATTGT -3'

Sequencing Primer
(F):5'- ATTGTAATCCCCAGGCCAAG -3'
(R):5'- GCAAAGTCGGTCTATAGTCAGTC -3'
Posted On2013-07-11