Incidental Mutation 'R7282:Acsl3'
ID 565691
Institutional Source Beutler Lab
Gene Symbol Acsl3
Ensembl Gene ENSMUSG00000032883
Gene Name acyl-CoA synthetase long-chain family member 3
Synonyms C85929, 2610510B12Rik, Facl3
Accession Numbers
Essential gene? Possibly essential (E-score: 0.544) question?
Stock # R7282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 78635600-78685462 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78659709 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 120 (N120K)
Ref Sequence ENSEMBL: ENSMUSP00000045291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000134566] [ENSMUST00000135642] [ENSMUST00000142704]
AlphaFold Q9CZW4
Predicted Effect probably damaging
Transcript: ENSMUST00000035779
AA Change: N120K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883
AA Change: N120K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134566
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135642
AA Change: N120K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116576
Gene: ENSMUSG00000032883
AA Change: N120K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142704
AA Change: N120K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883
AA Change: N120K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit decreased blood percentages of CD4 T cells and B cells, and a decreased IgG1 response to ovalbumin. Male mutant mice exhibit growth retardation, reduced size and reduced total tissue and lean body mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,316,582 (GRCm39) D187E probably damaging Het
Abl2 T C 1: 156,457,630 (GRCm39) Y299H probably damaging Het
Aldh1a1 A G 19: 20,606,434 (GRCm39) K255R possibly damaging Het
Baz2b C T 2: 59,750,781 (GRCm39) R1205H probably benign Het
Btbd8 G T 5: 107,655,062 (GRCm39) V954L probably benign Het
Btbd8 A G 5: 107,658,371 (GRCm39) D1647G probably damaging Het
Carmil1 A G 13: 24,197,387 (GRCm39) S1350P probably benign Het
Cecr2 A T 6: 120,738,582 (GRCm39) N325I Het
Cep120 C T 18: 53,873,161 (GRCm39) A57T probably damaging Het
Chst8 T C 7: 34,447,628 (GRCm39) probably null Het
Cntn4 A T 6: 106,502,421 (GRCm39) I393F probably damaging Het
Crocc T C 4: 140,749,652 (GRCm39) D1494G probably damaging Het
Cwc25 T C 11: 97,638,832 (GRCm39) E364G possibly damaging Het
Dnah7a C A 1: 53,724,059 (GRCm39) probably null Het
Drg2 A G 11: 60,345,519 (GRCm39) E5G probably benign Het
Ehd4 T C 2: 119,921,729 (GRCm39) H509R probably damaging Het
Enam A T 5: 88,650,186 (GRCm39) N565I probably damaging Het
Evi2a G T 11: 79,418,249 (GRCm39) N120K probably benign Het
Faim A G 9: 98,874,179 (GRCm39) T2A probably benign Het
Fcgbpl1 A G 7: 27,843,833 (GRCm39) N907S probably benign Het
Fmnl1 T C 11: 103,087,091 (GRCm39) V836A unknown Het
Fosb T C 7: 19,039,113 (GRCm39) I224V possibly damaging Het
Frem3 A T 8: 81,338,660 (GRCm39) T318S probably damaging Het
Gm9972 G A 11: 42,927,631 (GRCm39) G93R unknown Het
Gtf2a1 A T 12: 91,534,609 (GRCm39) I215N possibly damaging Het
Hs3st3b1 A G 11: 63,812,397 (GRCm39) V106A probably benign Het
Igkv19-93 T C 6: 68,713,485 (GRCm39) D48G probably benign Het
Itgb8 A T 12: 119,201,443 (GRCm39) W31R probably benign Het
Kmt2d A T 15: 98,751,985 (GRCm39) W1995R unknown Het
Lama3 G T 18: 12,572,449 (GRCm39) Q551H probably damaging Het
Lama5 T C 2: 179,843,588 (GRCm39) Y453C probably damaging Het
Lbhd2 G A 12: 111,376,724 (GRCm39) R57H probably damaging Het
Lcmt2 A G 2: 120,969,271 (GRCm39) V384A probably damaging Het
Lgsn T G 1: 31,242,452 (GRCm39) L178R probably damaging Het
Lhcgr C T 17: 89,065,811 (GRCm39) V193I probably benign Het
Lta4h T C 10: 93,289,373 (GRCm39) M1T probably null Het
Ly6l T C 15: 75,321,345 (GRCm39) S14P probably damaging Het
Met C A 6: 17,547,011 (GRCm39) C881* probably null Het
Mettl21e A T 1: 44,249,399 (GRCm39) Y86N probably damaging Het
Mgam A G 6: 40,740,045 (GRCm39) T1673A probably benign Het
Mgam A T 6: 40,633,446 (GRCm39) N251Y possibly damaging Het
Mmp27 T A 9: 7,578,231 (GRCm39) V357D probably damaging Het
Muc2 A G 7: 141,306,481 (GRCm39) E740G Het
Myoc C A 1: 162,476,413 (GRCm39) S372R probably benign Het
Ncor2 A T 5: 125,097,104 (GRCm39) M1358K Het
Nol6 A G 4: 41,119,468 (GRCm39) S613P probably benign Het
Nuggc T A 14: 65,855,072 (GRCm39) I334N probably damaging Het
Nxnl2 C T 13: 51,325,542 (GRCm39) P62S probably damaging Het
Ogfod1 C T 8: 94,764,067 (GRCm39) H51Y possibly damaging Het
Olfml1 T A 7: 107,189,530 (GRCm39) D198E possibly damaging Het
Or2t26 A C 11: 49,039,945 (GRCm39) N287T probably damaging Het
Ovch2 C T 7: 107,393,577 (GRCm39) R183H possibly damaging Het
Plxnd1 A T 6: 115,937,798 (GRCm39) L1516Q probably damaging Het
Pramel27 A G 4: 143,578,451 (GRCm39) N237S possibly damaging Het
Prrc2c A G 1: 162,507,543 (GRCm39) V2448A possibly damaging Het
Rexo5 C T 7: 119,417,636 (GRCm39) T212I probably damaging Het
Rgl2 C T 17: 34,152,403 (GRCm39) R367W probably damaging Het
Rnf213 T G 11: 119,328,818 (GRCm39) I2030S Het
Rtf1 C T 2: 119,505,580 (GRCm39) A11V unknown Het
Setdb1 T G 3: 95,245,985 (GRCm39) T647P probably damaging Het
Shisa6 G C 11: 66,393,480 (GRCm39) P272R possibly damaging Het
Slc25a54 G T 3: 109,023,817 (GRCm39) G471* probably null Het
Slc30a1 A G 1: 191,641,544 (GRCm39) T397A probably benign Het
Slc7a14 A G 3: 31,281,302 (GRCm39) F336S possibly damaging Het
Slitrk3 C T 3: 72,957,798 (GRCm39) V325I possibly damaging Het
Sptan1 A G 2: 29,876,941 (GRCm39) Y361C probably damaging Het
Stard9 A G 2: 120,528,984 (GRCm39) D1747G probably benign Het
Taf3 T C 2: 9,956,253 (GRCm39) E638G probably damaging Het
Tbc1d8 T C 1: 39,411,614 (GRCm39) D1074G probably benign Het
Tecrl G A 5: 83,502,754 (GRCm39) H32Y probably benign Het
Tgm3 T A 2: 129,866,481 (GRCm39) M133K probably benign Het
Tmem131 A G 1: 36,880,685 (GRCm39) F195S probably damaging Het
Tmem82 T C 4: 141,342,261 (GRCm39) I314V possibly damaging Het
Trappc10 T C 10: 78,043,327 (GRCm39) E555G probably damaging Het
Ubn2 A T 6: 38,429,811 (GRCm39) K176* probably null Het
Ucp1 G A 8: 84,020,531 (GRCm39) G114R probably benign Het
Unc5c A G 3: 141,383,751 (GRCm39) D43G probably damaging Het
Vmn2r3 C T 3: 64,168,825 (GRCm39) V571M possibly damaging Het
Vwa3a A T 7: 120,385,688 (GRCm39) I677L probably benign Het
Wdr48 T C 9: 119,740,147 (GRCm39) S319P probably damaging Het
Other mutations in Acsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsl3 APN 1 78,677,476 (GRCm39) missense possibly damaging 0.79
IGL02201:Acsl3 APN 1 78,676,870 (GRCm39) missense probably damaging 1.00
IGL03162:Acsl3 APN 1 78,676,887 (GRCm39) critical splice donor site probably null
R0601:Acsl3 UTSW 1 78,673,896 (GRCm39) missense probably damaging 1.00
R0658:Acsl3 UTSW 1 78,679,004 (GRCm39) missense probably damaging 1.00
R1389:Acsl3 UTSW 1 78,665,999 (GRCm39) missense probably benign
R1468:Acsl3 UTSW 1 78,684,126 (GRCm39) missense probably benign 0.03
R1468:Acsl3 UTSW 1 78,684,126 (GRCm39) missense probably benign 0.03
R1697:Acsl3 UTSW 1 78,683,114 (GRCm39) splice site probably benign
R2083:Acsl3 UTSW 1 78,677,528 (GRCm39) missense probably damaging 0.99
R2125:Acsl3 UTSW 1 78,659,678 (GRCm39) missense probably damaging 0.97
R2191:Acsl3 UTSW 1 78,676,857 (GRCm39) missense probably damaging 1.00
R2299:Acsl3 UTSW 1 78,676,827 (GRCm39) missense probably damaging 1.00
R2395:Acsl3 UTSW 1 78,683,085 (GRCm39) missense probably benign 0.00
R2964:Acsl3 UTSW 1 78,672,011 (GRCm39) missense probably benign 0.01
R3403:Acsl3 UTSW 1 78,673,839 (GRCm39) missense probably damaging 1.00
R4655:Acsl3 UTSW 1 78,668,063 (GRCm39) missense probably damaging 1.00
R5537:Acsl3 UTSW 1 78,684,073 (GRCm39) missense probably damaging 1.00
R5823:Acsl3 UTSW 1 78,666,003 (GRCm39) missense probably benign
R6239:Acsl3 UTSW 1 78,674,182 (GRCm39) missense probably benign 0.00
R6376:Acsl3 UTSW 1 78,674,182 (GRCm39) missense possibly damaging 0.81
R6650:Acsl3 UTSW 1 78,659,639 (GRCm39) missense probably benign 0.03
R7031:Acsl3 UTSW 1 78,666,000 (GRCm39) missense probably benign
R7733:Acsl3 UTSW 1 78,665,953 (GRCm39) critical splice acceptor site probably null
R7891:Acsl3 UTSW 1 78,681,305 (GRCm39) missense probably benign 0.02
R7998:Acsl3 UTSW 1 78,671,988 (GRCm39) missense probably damaging 1.00
R8056:Acsl3 UTSW 1 78,659,611 (GRCm39) missense probably damaging 1.00
R8083:Acsl3 UTSW 1 78,669,844 (GRCm39) missense probably damaging 1.00
R8084:Acsl3 UTSW 1 78,669,844 (GRCm39) missense probably damaging 1.00
R8135:Acsl3 UTSW 1 78,674,712 (GRCm39) missense probably benign 0.00
R8982:Acsl3 UTSW 1 78,677,485 (GRCm39) missense probably benign 0.00
R9267:Acsl3 UTSW 1 78,674,623 (GRCm39) missense probably damaging 1.00
R9380:Acsl3 UTSW 1 78,659,602 (GRCm39) missense possibly damaging 0.47
X0025:Acsl3 UTSW 1 78,669,919 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCAGTTCCAAACCGGAC -3'
(R):5'- CCATACAGGGCACATTCTCC -3'

Sequencing Primer
(F):5'- GTTCCAAACCGGACTCTGC -3'
(R):5'- CTCCATGCCTTTCTGAAAAATAGGTC -3'
Posted On 2019-06-26