Incidental Mutation 'R0584:Spag5'
ID56570
Institutional Source Beutler Lab
Gene Symbol Spag5
Ensembl Gene ENSMUSG00000002055
Gene Namesperm associated antigen 5
SynonymsD11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17
MMRRC Submission 038774-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0584 (G1)
Quality Score150
Status Validated
Chromosome11
Chromosomal Location78301529-78322457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78304095 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 76 (N76S)
Ref Sequence ENSEMBL: ENSMUSP00000045286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045026]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045026
AA Change: N76S

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055
AA Change: N76S

DomainStartEndE-ValueType
low complexity region 405 420 N/A INTRINSIC
low complexity region 477 493 N/A INTRINSIC
coiled coil region 514 547 N/A INTRINSIC
coiled coil region 638 700 N/A INTRINSIC
coiled coil region 743 854 N/A INTRINSIC
low complexity region 898 912 N/A INTRINSIC
coiled coil region 970 1006 N/A INTRINSIC
coiled coil region 1032 1068 N/A INTRINSIC
coiled coil region 1104 1140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146068
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,011,730 S1745P probably damaging Het
Agfg2 G A 5: 137,667,730 T89I probably damaging Het
Agtr1a A G 13: 30,381,034 I27M probably damaging Het
Armh1 A T 4: 117,229,850 L206Q probably damaging Het
Asxl2 A T 12: 3,496,632 E472V probably damaging Het
Atp2c2 T A 8: 119,738,418 V313E probably benign Het
Casp12 A G 9: 5,352,268 I87V probably null Het
Ccl25 C T 8: 4,354,085 probably benign Het
Col9a1 T C 1: 24,224,490 probably benign Het
Cyth4 A G 15: 78,609,878 probably null Het
Dnah9 A G 11: 65,990,489 Y2587H probably damaging Het
Dppa3 T C 6: 122,629,992 I147T probably benign Het
Fam120b T C 17: 15,402,122 S121P probably damaging Het
Fam209 C T 2: 172,474,161 T152M probably benign Het
Fam98a A G 17: 75,544,777 L103P probably damaging Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fitm1 T C 14: 55,576,656 V203A probably benign Het
Gcn1l1 G A 5: 115,595,015 R1037Q probably damaging Het
Gm11563 A G 11: 99,658,625 I101T unknown Het
Gpd1l A G 9: 114,914,344 F163L probably damaging Het
Grp C A 18: 65,873,695 A30E possibly damaging Het
H1fnt C A 15: 98,257,077 E64* probably null Het
Icosl T C 10: 78,071,875 Y90H possibly damaging Het
Itsn2 A G 12: 4,697,180 T1194A probably benign Het
Lrp6 A G 6: 134,456,076 S1431P probably damaging Het
Ltbp1 T C 17: 75,363,472 S1503P probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Myh13 G T 11: 67,360,374 E1360* probably null Het
Nop58 A G 1: 59,706,760 D400G probably benign Het
Olfr507 T C 7: 108,622,415 L201P probably benign Het
Olfr775 T C 10: 129,250,948 V138A probably benign Het
Oscp1 A G 4: 126,083,594 probably null Het
Pde9a A T 17: 31,459,977 Y264F probably damaging Het
Pkhd1 T A 1: 20,239,436 K2763* probably null Het
Prkci T A 3: 31,025,140 C42* probably null Het
Ptprr T C 10: 116,251,158 V270A probably damaging Het
Rsf1 T A 7: 97,662,128 N688K possibly damaging Het
S1pr3 A T 13: 51,419,661 M293L probably benign Het
Scn10a A C 9: 119,670,531 L232R probably damaging Het
Sirt5 T A 13: 43,394,728 probably null Het
Sp6 C T 11: 97,022,265 T268M probably damaging Het
Tecta T C 9: 42,347,908 N1560D possibly damaging Het
Togaram1 T C 12: 64,967,505 L510P probably damaging Het
Umps A G 16: 33,959,124 I401T probably damaging Het
Vars2 A G 17: 35,666,686 V118A possibly damaging Het
Other mutations in Spag5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Spag5 APN 11 78304617 missense possibly damaging 0.62
IGL01820:Spag5 APN 11 78304259 missense probably benign 0.06
IGL02066:Spag5 APN 11 78304532 missense probably benign
IGL02140:Spag5 APN 11 78315633 missense possibly damaging 0.62
IGL02251:Spag5 APN 11 78320034 missense probably damaging 1.00
IGL02452:Spag5 APN 11 78304623 missense probably benign 0.08
IGL02658:Spag5 APN 11 78321331 nonsense probably null
boyardee UTSW 11 78313191 critical splice donor site probably null
Franco UTSW 11 78314182 nonsense probably null
spaghetto UTSW 11 78313379 nonsense probably null
IGL02991:Spag5 UTSW 11 78314251 missense probably damaging 0.99
R0477:Spag5 UTSW 11 78314198 missense probably damaging 1.00
R0512:Spag5 UTSW 11 78319586 unclassified probably benign
R0535:Spag5 UTSW 11 78304728 missense probably benign 0.00
R0557:Spag5 UTSW 11 78314211 missense probably damaging 0.99
R0666:Spag5 UTSW 11 78313396 missense probably damaging 1.00
R0723:Spag5 UTSW 11 78319584 unclassified probably benign
R1413:Spag5 UTSW 11 78305317 nonsense probably null
R1680:Spag5 UTSW 11 78320616 missense probably damaging 1.00
R1687:Spag5 UTSW 11 78304929 missense probably benign 0.32
R1696:Spag5 UTSW 11 78321326 missense probably damaging 1.00
R1831:Spag5 UTSW 11 78314256 missense probably benign 0.08
R1866:Spag5 UTSW 11 78304455 missense possibly damaging 0.62
R1918:Spag5 UTSW 11 78304176 missense probably benign 0.01
R4004:Spag5 UTSW 11 78321529 missense probably benign 0.22
R4005:Spag5 UTSW 11 78321529 missense probably benign 0.22
R4222:Spag5 UTSW 11 78304511 missense probably damaging 1.00
R4750:Spag5 UTSW 11 78320052 missense probably benign 0.00
R4771:Spag5 UTSW 11 78304766 missense probably damaging 1.00
R4928:Spag5 UTSW 11 78314373 missense probably damaging 0.97
R5360:Spag5 UTSW 11 78314762 missense probably damaging 0.99
R5366:Spag5 UTSW 11 78320326 splice site probably null
R5618:Spag5 UTSW 11 78304080 missense probably benign 0.00
R5668:Spag5 UTSW 11 78304716 missense possibly damaging 0.53
R5762:Spag5 UTSW 11 78304146 missense probably benign 0.25
R5859:Spag5 UTSW 11 78313534 missense probably benign 0.38
R6564:Spag5 UTSW 11 78315575 missense probably damaging 1.00
R6571:Spag5 UTSW 11 78321269 missense probably damaging 1.00
R6573:Spag5 UTSW 11 78314182 nonsense probably null
R7074:Spag5 UTSW 11 78305042 critical splice donor site probably null
R7091:Spag5 UTSW 11 78313191 critical splice donor site probably null
R7332:Spag5 UTSW 11 78313379 nonsense probably null
R8073:Spag5 UTSW 11 78301977 missense probably benign 0.22
Z1176:Spag5 UTSW 11 78314982 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CAGGGTCATAGTCAAGGTAGAGTCTCC -3'
(R):5'- TCTTGCTGCTGCCCTAATGAAAAGG -3'

Sequencing Primer
(F):5'- CCCCTATATGTACGGGATGCATAAG -3'
(R):5'- CCCTAATGAAAAGGGCAGAAGAAC -3'
Posted On2013-07-11