Incidental Mutation 'R0584:Sp6'
ID 56571
Institutional Source Beutler Lab
Gene Symbol Sp6
Ensembl Gene ENSMUSG00000038560
Gene Name trans-acting transcription factor 6
Synonyms Epfn, Klf14, epiprofin, 1110025J03Rik
MMRRC Submission 038774-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.451) question?
Stock # R0584 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 96904395-96915565 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 96913091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 268 (T268M)
Ref Sequence ENSEMBL: ENSMUSP00000103248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047997] [ENSMUST00000107622]
AlphaFold Q9ESX2
Predicted Effect probably damaging
Transcript: ENSMUST00000047997
AA Change: T268M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039307
Gene: ENSMUSG00000038560
AA Change: T268M

DomainStartEndE-ValueType
low complexity region 163 177 N/A INTRINSIC
ZnF_C2H2 254 278 3.99e0 SMART
ZnF_C2H2 284 308 2.99e-4 SMART
ZnF_C2H2 314 336 3.16e-3 SMART
low complexity region 337 364 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107622
AA Change: T268M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103248
Gene: ENSMUSG00000038560
AA Change: T268M

DomainStartEndE-ValueType
low complexity region 163 177 N/A INTRINSIC
ZnF_C2H2 254 278 3.99e0 SMART
ZnF_C2H2 284 308 2.99e-4 SMART
ZnF_C2H2 314 336 3.16e-3 SMART
low complexity region 337 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128111
Meta Mutation Damage Score 0.1950 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SP6 belongs to a family of transcription factors that contain 3 classical zinc finger DNA-binding domains consisting of a zinc atom tetrahedrally coordinated by 2 cysteines and 2 histidines (C2H2 motif). These transcription factors bind to GC-rich sequences and related GT and CACCC boxes (Scohy et al., 2000 [PubMed 11087666]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a disruption at this locus display impaired skin, hair follicle, tooth and lung development as well as limb abnormalities and partial postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 79,847,564 (GRCm39) S1745P probably damaging Het
Agfg2 G A 5: 137,665,992 (GRCm39) T89I probably damaging Het
Agtr1a A G 13: 30,565,017 (GRCm39) I27M probably damaging Het
Armh1 A T 4: 117,087,047 (GRCm39) L206Q probably damaging Het
Asxl2 A T 12: 3,546,632 (GRCm39) E472V probably damaging Het
Atp2c2 T A 8: 120,465,157 (GRCm39) V313E probably benign Het
Casp12 A G 9: 5,352,268 (GRCm39) I87V probably null Het
Ccl25 C T 8: 4,404,085 (GRCm39) probably benign Het
Col9a1 T C 1: 24,263,571 (GRCm39) probably benign Het
Cyth4 A G 15: 78,494,078 (GRCm39) probably null Het
Dnah9 A G 11: 65,881,315 (GRCm39) Y2587H probably damaging Het
Dppa3 T C 6: 122,606,951 (GRCm39) I147T probably benign Het
Fam120b T C 17: 15,622,384 (GRCm39) S121P probably damaging Het
Fam209 C T 2: 172,316,081 (GRCm39) T152M probably benign Het
Fam98a A G 17: 75,851,772 (GRCm39) L103P probably damaging Het
Fcho1 T C 8: 72,168,369 (GRCm39) Y218C probably damaging Het
Fitm1 T C 14: 55,814,113 (GRCm39) V203A probably benign Het
Gcn1 G A 5: 115,733,074 (GRCm39) R1037Q probably damaging Het
Gm11563 A G 11: 99,549,451 (GRCm39) I101T unknown Het
Gpd1l A G 9: 114,743,412 (GRCm39) F163L probably damaging Het
Grp C A 18: 66,006,766 (GRCm39) A30E possibly damaging Het
H1f7 C A 15: 98,154,958 (GRCm39) E64* probably null Het
Icosl T C 10: 77,907,709 (GRCm39) Y90H possibly damaging Het
Itsn2 A G 12: 4,747,180 (GRCm39) T1194A probably benign Het
Lrp6 A G 6: 134,433,039 (GRCm39) S1431P probably damaging Het
Ltbp1 T C 17: 75,670,467 (GRCm39) S1503P probably damaging Het
Mef2a G T 7: 66,884,896 (GRCm39) S406* probably null Het
Myh13 G T 11: 67,251,200 (GRCm39) E1360* probably null Het
Nop58 A G 1: 59,745,919 (GRCm39) D400G probably benign Het
Or5p79 T C 7: 108,221,622 (GRCm39) L201P probably benign Het
Or6c205 T C 10: 129,086,817 (GRCm39) V138A probably benign Het
Oscp1 A G 4: 125,977,387 (GRCm39) probably null Het
Pde9a A T 17: 31,678,951 (GRCm39) Y264F probably damaging Het
Pkhd1 T A 1: 20,309,660 (GRCm39) K2763* probably null Het
Prkci T A 3: 31,079,289 (GRCm39) C42* probably null Het
Ptprr T C 10: 116,087,063 (GRCm39) V270A probably damaging Het
Rsf1 T A 7: 97,311,335 (GRCm39) N688K possibly damaging Het
S1pr3 A T 13: 51,573,697 (GRCm39) M293L probably benign Het
Scn10a A C 9: 119,499,597 (GRCm39) L232R probably damaging Het
Sirt5 T A 13: 43,548,204 (GRCm39) probably null Het
Spag5 A G 11: 78,194,921 (GRCm39) N76S possibly damaging Het
Tecta T C 9: 42,259,204 (GRCm39) N1560D possibly damaging Het
Togaram1 T C 12: 65,014,279 (GRCm39) L510P probably damaging Het
Umps A G 16: 33,779,494 (GRCm39) I401T probably damaging Het
Vars2 A G 17: 35,977,578 (GRCm39) V118A possibly damaging Het
Other mutations in Sp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sp6 APN 11 96,913,429 (GRCm39) utr 3 prime probably benign
R0281:Sp6 UTSW 11 96,912,751 (GRCm39) missense probably benign 0.24
R0326:Sp6 UTSW 11 96,912,361 (GRCm39) missense possibly damaging 0.90
R0678:Sp6 UTSW 11 96,912,607 (GRCm39) missense probably damaging 0.99
R0690:Sp6 UTSW 11 96,912,370 (GRCm39) missense possibly damaging 0.89
R1909:Sp6 UTSW 11 96,912,334 (GRCm39) missense probably benign 0.04
R1950:Sp6 UTSW 11 96,912,940 (GRCm39) missense probably benign 0.14
R3697:Sp6 UTSW 11 96,912,580 (GRCm39) missense possibly damaging 0.86
R4380:Sp6 UTSW 11 96,912,572 (GRCm39) missense probably damaging 0.98
R4666:Sp6 UTSW 11 96,912,701 (GRCm39) missense probably benign 0.19
R8701:Sp6 UTSW 11 96,913,090 (GRCm39) missense probably damaging 1.00
X0011:Sp6 UTSW 11 96,913,351 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AAAGGCTCCCGGCGATCAGTTC -3'
(R):5'- TTCAAGCAGCCTCCCATGTAGCCC -3'

Sequencing Primer
(F):5'- GATCAGTTCCCCGCAGCTC -3'
(R):5'- ACGGCAGGTATGTGACATCC -3'
Posted On 2013-07-11