Incidental Mutation 'R7282:Unc5c'
ID565710
Institutional Source Beutler Lab
Gene Symbol Unc5c
Ensembl Gene ENSMUSG00000059921
Gene Nameunc-5 netrin receptor C
SynonymsB130051O18Rik, Unc5h3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7282 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location141465216-141834924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141677990 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 43 (D43G)
Ref Sequence ENSEMBL: ENSMUSP00000074758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075282] [ENSMUST00000106236] [ENSMUST00000130636] [ENSMUST00000142762]
Predicted Effect probably damaging
Transcript: ENSMUST00000075282
AA Change: D43G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074758
Gene: ENSMUSG00000059921
AA Change: D43G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106236
AA Change: D43G

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101843
Gene: ENSMUSG00000059921
AA Change: D43G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 377 399 N/A INTRINSIC
ZU5 528 631 6.92e-63 SMART
low complexity region 676 685 N/A INTRINSIC
DEATH 838 929 6.68e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130636
SMART Domains Protein: ENSMUSP00000117487
Gene: ENSMUSG00000059921

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
IGc2 105 172 2.72e-5 SMART
TSP1 189 240 8.54e-13 SMART
TSP1 245 294 1.18e-6 SMART
transmembrane domain 322 344 N/A INTRINSIC
ZU5 473 576 6.92e-63 SMART
low complexity region 621 630 N/A INTRINSIC
DEATH 783 874 6.68e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142762
AA Change: D43G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118212
Gene: ENSMUSG00000059921
AA Change: D43G

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
SCOP:d2fcba2 64 164 9e-3 SMART
IGc2 179 246 2.72e-5 SMART
TSP1 263 314 8.54e-13 SMART
TSP1 319 368 1.18e-6 SMART
transmembrane domain 396 418 N/A INTRINSIC
ZU5 547 650 6.92e-63 SMART
low complexity region 695 704 N/A INTRINSIC
DEATH 857 948 6.68e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the UNC-5 family of netrin receptors. Netrins are secreted proteins that direct axon extension and cell migration during neural development. They are bifunctional proteins that act as attractants for some cell types and as repellents for others, and these opposite actions are thought to be mediated by two classes of receptors. The UNC-5 family of receptors mediate the repellent response to netrin; they are transmembrane proteins containing 2 immunoglobulin (Ig)-like domains and 2 type I thrombospondin motifs in the extracellular region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants exhibit ataxia, and reduced size early in life. Mutants exhibit cerebellar defects including reduced size and ectopic cerebellar cells in the midbrain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,425,756 D187E probably damaging Het
9530053A07Rik A G 7: 28,144,408 N907S probably benign Het
A830010M20Rik G T 5: 107,507,196 V954L probably benign Het
A830010M20Rik A G 5: 107,510,505 D1647G probably damaging Het
Abl2 T C 1: 156,630,060 Y299H probably damaging Het
Acsl3 T A 1: 78,681,992 N120K probably damaging Het
Aldh1a1 A G 19: 20,629,070 K255R possibly damaging Het
Baz2b C T 2: 59,920,437 R1205H probably benign Het
Carmil1 A G 13: 24,013,404 S1350P probably benign Het
Cecr2 A T 6: 120,761,621 N325I Het
Cep120 C T 18: 53,740,089 A57T probably damaging Het
Chst8 T C 7: 34,748,203 probably null Het
Cntn4 A T 6: 106,525,460 I393F probably damaging Het
Crocc T C 4: 141,022,341 D1494G probably damaging Het
Cwc25 T C 11: 97,748,006 E364G possibly damaging Het
Dnah7a C A 1: 53,684,900 probably null Het
Drg2 A G 11: 60,454,693 E5G probably benign Het
Ehd4 T C 2: 120,091,248 H509R probably damaging Het
Enam A T 5: 88,502,327 N565I probably damaging Het
Evi2a G T 11: 79,527,423 N120K probably benign Het
Faim A G 9: 98,992,126 T2A probably benign Het
Fmnl1 T C 11: 103,196,265 V836A unknown Het
Fosb T C 7: 19,305,188 I224V possibly damaging Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gm13103 A G 4: 143,851,881 N237S possibly damaging Het
Gm9972 G A 11: 43,036,804 G93R unknown Het
Gtf2a1 A T 12: 91,567,835 I215N possibly damaging Het
Hs3st3b1 A G 11: 63,921,571 V106A probably benign Het
Igkv19-93 T C 6: 68,736,501 D48G probably benign Het
Itgb8 A T 12: 119,237,708 W31R probably benign Het
Kmt2d A T 15: 98,854,104 W1995R unknown Het
Lama3 G T 18: 12,439,392 Q551H probably damaging Het
Lama5 T C 2: 180,201,795 Y453C probably damaging Het
Lbhd2 G A 12: 111,410,290 R57H probably damaging Het
Lcmt2 A G 2: 121,138,790 V384A probably damaging Het
Lgsn T G 1: 31,203,371 L178R probably damaging Het
Lhcgr C T 17: 88,758,383 V193I probably benign Het
Lta4h T C 10: 93,453,511 M1T probably null Het
Ly6l T C 15: 75,449,496 S14P probably damaging Het
Met C A 6: 17,547,012 C881* probably null Het
Mettl21e A T 1: 44,210,239 Y86N probably damaging Het
Mgam A T 6: 40,656,512 N251Y possibly damaging Het
Mgam A G 6: 40,763,111 T1673A probably benign Het
Mmp27 T A 9: 7,578,230 V357D probably damaging Het
Muc2 A G 7: 141,752,744 E740G Het
Myoc C A 1: 162,648,844 S372R probably benign Het
Ncor2 A T 5: 125,020,040 M1358K Het
Nol6 A G 4: 41,119,468 S613P probably benign Het
Nuggc T A 14: 65,617,623 I334N probably damaging Het
Nxnl2 C T 13: 51,171,506 P62S probably damaging Het
Ogfod1 C T 8: 94,037,439 H51Y possibly damaging Het
Olfml1 T A 7: 107,590,323 D198E possibly damaging Het
Olfr1395 A C 11: 49,149,118 N287T probably damaging Het
Ovch2 C T 7: 107,794,370 R183H possibly damaging Het
Plxnd1 A T 6: 115,960,837 L1516Q probably damaging Het
Prrc2c A G 1: 162,679,974 V2448A possibly damaging Het
Rexo5 C T 7: 119,818,413 T212I probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rnf213 T G 11: 119,437,992 I2030S Het
Rtf1 C T 2: 119,675,099 A11V unknown Het
Setdb1 T G 3: 95,338,674 T647P probably damaging Het
Shisa6 G C 11: 66,502,654 P272R possibly damaging Het
Slc25a54 G T 3: 109,116,501 G471* probably null Het
Slc30a1 A G 1: 191,909,432 T397A probably benign Het
Slc7a14 A G 3: 31,227,153 F336S possibly damaging Het
Slitrk3 C T 3: 73,050,465 V325I possibly damaging Het
Sptan1 A G 2: 29,986,929 Y361C probably damaging Het
Stard9 A G 2: 120,698,503 D1747G probably benign Het
Taf3 T C 2: 9,951,442 E638G probably damaging Het
Tbc1d8 T C 1: 39,372,533 D1074G probably benign Het
Tecrl G A 5: 83,354,907 H32Y probably benign Het
Tgm3 T A 2: 130,024,561 M133K probably benign Het
Tmem131 A G 1: 36,841,604 F195S probably damaging Het
Tmem82 T C 4: 141,614,950 I314V possibly damaging Het
Trappc10 T C 10: 78,207,493 E555G probably damaging Het
Ubn2 A T 6: 38,452,876 K176* probably null Het
Ucp1 G A 8: 83,293,902 G114R probably benign Het
Vmn2r3 C T 3: 64,261,404 V571M possibly damaging Het
Vwa3a A T 7: 120,786,465 I677L probably benign Het
Wdr48 T C 9: 119,911,081 S319P probably damaging Het
Other mutations in Unc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Unc5c APN 3 141788940 missense probably damaging 0.99
IGL01089:Unc5c APN 3 141818202 splice site probably benign
IGL01478:Unc5c APN 3 141828451 missense probably damaging 1.00
IGL02083:Unc5c APN 3 141714647 missense probably damaging 0.99
IGL02269:Unc5c APN 3 141788982 missense probably damaging 1.00
IGL02565:Unc5c APN 3 141803919 missense probably damaging 1.00
IGL02973:Unc5c APN 3 141788890 missense probably benign 0.12
R0179:Unc5c UTSW 3 141818067 nonsense probably null
R0309:Unc5c UTSW 3 141733933 missense probably benign 0.01
R0371:Unc5c UTSW 3 141827522 missense probably benign 0.01
R0603:Unc5c UTSW 3 141771102 missense probably damaging 1.00
R0904:Unc5c UTSW 3 141803840 missense probably benign 0.08
R0907:Unc5c UTSW 3 141789033 missense probably damaging 0.99
R1300:Unc5c UTSW 3 141828543 missense possibly damaging 0.94
R1491:Unc5c UTSW 3 141789822 missense probably damaging 1.00
R1494:Unc5c UTSW 3 141827549 missense possibly damaging 0.93
R1674:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1676:Unc5c UTSW 3 141757837 missense possibly damaging 0.74
R1726:Unc5c UTSW 3 141818103 missense probably damaging 1.00
R1750:Unc5c UTSW 3 141827517 missense possibly damaging 0.89
R1815:Unc5c UTSW 3 141757757 missense probably damaging 1.00
R2381:Unc5c UTSW 3 141678155 missense probably damaging 1.00
R2394:Unc5c UTSW 3 141678131 missense probably damaging 1.00
R2945:Unc5c UTSW 3 141789974 missense probably damaging 0.97
R4284:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4285:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4287:Unc5c UTSW 3 141714674 missense probably damaging 1.00
R4681:Unc5c UTSW 3 141768613 critical splice donor site probably null
R4736:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4740:Unc5c UTSW 3 141816931 missense probably benign 0.00
R4774:Unc5c UTSW 3 141828517 missense probably damaging 1.00
R4862:Unc5c UTSW 3 141789773 missense probably damaging 1.00
R4905:Unc5c UTSW 3 141801310 missense probably benign 0.19
R4921:Unc5c UTSW 3 141788966 missense probably damaging 1.00
R5150:Unc5c UTSW 3 141757793 missense probably damaging 1.00
R5559:Unc5c UTSW 3 141803787 missense probably damaging 1.00
R5562:Unc5c UTSW 3 141768530 missense probably damaging 1.00
R5643:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5644:Unc5c UTSW 3 141678125 missense probably damaging 1.00
R5775:Unc5c UTSW 3 141828520 missense probably damaging 1.00
R5912:Unc5c UTSW 3 141789006 missense probably damaging 1.00
R6154:Unc5c UTSW 3 141678153 missense probably damaging 0.97
R6547:Unc5c UTSW 3 141790019 missense probably benign 0.16
R6558:Unc5c UTSW 3 141789729 missense probably damaging 0.98
R7104:Unc5c UTSW 3 141733904 missense probably damaging 1.00
R7113:Unc5c UTSW 3 141801293 missense probably benign 0.00
R7317:Unc5c UTSW 3 141789942 missense probably benign 0.00
R7787:Unc5c UTSW 3 141768552 missense probably damaging 1.00
R7873:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7896:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R7956:Unc5c UTSW 3 141827549 missense probably benign 0.04
R7979:Unc5c UTSW 3 141771161 missense possibly damaging 0.73
R8041:Unc5c UTSW 3 141465784 missense possibly damaging 0.92
X0018:Unc5c UTSW 3 141714739 missense probably damaging 1.00
X0065:Unc5c UTSW 3 141827661 missense probably damaging 1.00
Z1088:Unc5c UTSW 3 141733900 missense probably damaging 1.00
Z1176:Unc5c UTSW 3 141678010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGACTTCATTTTGCAGATTGC -3'
(R):5'- ATGAACCCACTCGCTGTTG -3'

Sequencing Primer
(F):5'- GGACTTCATTTTGCAGATTGCTACTC -3'
(R):5'- CACTCGCTGTTGCACTTGAAGTAG -3'
Posted On2019-06-26