Incidental Mutation 'R0584:Gm11563'
ID56572
Institutional Source Beutler Lab
Gene Symbol Gm11563
Ensembl Gene ENSMUSG00000069718
Gene Namepredicted gene 11563
Synonyms
MMRRC Submission 038774-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0584 (G1)
Quality Score181
Status Validated
Chromosome11
Chromosomal Location99657949-99658960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99658625 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 101 (I101T)
Ref Sequence ENSEMBL: ENSMUSP00000090369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092695]
Predicted Effect unknown
Transcript: ENSMUST00000092695
AA Change: I101T
SMART Domains Protein: ENSMUSP00000090369
Gene: ENSMUSG00000069718
AA Change: I101T

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 58 3.9e-10 PFAM
Pfam:Keratin_B2_2 44 88 7.8e-16 PFAM
Pfam:Keratin_B2_2 59 102 3.7e-14 PFAM
internal_repeat_1 142 157 9.92e-7 PROSPERO
internal_repeat_1 152 167 9.92e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119334
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,011,730 S1745P probably damaging Het
Agfg2 G A 5: 137,667,730 T89I probably damaging Het
Agtr1a A G 13: 30,381,034 I27M probably damaging Het
Armh1 A T 4: 117,229,850 L206Q probably damaging Het
Asxl2 A T 12: 3,496,632 E472V probably damaging Het
Atp2c2 T A 8: 119,738,418 V313E probably benign Het
Casp12 A G 9: 5,352,268 I87V probably null Het
Ccl25 C T 8: 4,354,085 probably benign Het
Col9a1 T C 1: 24,224,490 probably benign Het
Cyth4 A G 15: 78,609,878 probably null Het
Dnah9 A G 11: 65,990,489 Y2587H probably damaging Het
Dppa3 T C 6: 122,629,992 I147T probably benign Het
Fam120b T C 17: 15,402,122 S121P probably damaging Het
Fam209 C T 2: 172,474,161 T152M probably benign Het
Fam98a A G 17: 75,544,777 L103P probably damaging Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fitm1 T C 14: 55,576,656 V203A probably benign Het
Gcn1l1 G A 5: 115,595,015 R1037Q probably damaging Het
Gpd1l A G 9: 114,914,344 F163L probably damaging Het
Grp C A 18: 65,873,695 A30E possibly damaging Het
H1fnt C A 15: 98,257,077 E64* probably null Het
Icosl T C 10: 78,071,875 Y90H possibly damaging Het
Itsn2 A G 12: 4,697,180 T1194A probably benign Het
Lrp6 A G 6: 134,456,076 S1431P probably damaging Het
Ltbp1 T C 17: 75,363,472 S1503P probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Myh13 G T 11: 67,360,374 E1360* probably null Het
Nop58 A G 1: 59,706,760 D400G probably benign Het
Olfr507 T C 7: 108,622,415 L201P probably benign Het
Olfr775 T C 10: 129,250,948 V138A probably benign Het
Oscp1 A G 4: 126,083,594 probably null Het
Pde9a A T 17: 31,459,977 Y264F probably damaging Het
Pkhd1 T A 1: 20,239,436 K2763* probably null Het
Prkci T A 3: 31,025,140 C42* probably null Het
Ptprr T C 10: 116,251,158 V270A probably damaging Het
Rsf1 T A 7: 97,662,128 N688K possibly damaging Het
S1pr3 A T 13: 51,419,661 M293L probably benign Het
Scn10a A C 9: 119,670,531 L232R probably damaging Het
Sirt5 T A 13: 43,394,728 probably null Het
Sp6 C T 11: 97,022,265 T268M probably damaging Het
Spag5 A G 11: 78,304,095 N76S possibly damaging Het
Tecta T C 9: 42,347,908 N1560D possibly damaging Het
Togaram1 T C 12: 64,967,505 L510P probably damaging Het
Umps A G 16: 33,959,124 I401T probably damaging Het
Vars2 A G 17: 35,666,686 V118A possibly damaging Het
Other mutations in Gm11563
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:Gm11563 APN 11 99658701 nonsense probably null
IGL02125:Gm11563 APN 11 99658805 missense unknown
R0551:Gm11563 UTSW 11 99658713 missense unknown
R0620:Gm11563 UTSW 11 99658437 missense unknown
R1246:Gm11563 UTSW 11 99658848 missense unknown
R4575:Gm11563 UTSW 11 99658449 missense unknown
R4745:Gm11563 UTSW 11 99658420 makesense probably null
R5279:Gm11563 UTSW 11 99658713 missense unknown
R6945:Gm11563 UTSW 11 99658472 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTTCCTGAGTCTGGGGCATGAAC -3'
(R):5'- GTCTGTGTGTTGCCAGCCTACC -3'

Sequencing Primer
(F):5'- GTTCAAGAAAGTTCTCAGCAGC -3'
(R):5'- GCCAGCCTACCTGCTGC -3'
Posted On2013-07-11