Incidental Mutation 'R7282:Mgam'
ID 565722
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Name maltase-glucoamylase
Synonyms 6030407P20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock # R7282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 40628831-40769123 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 40656512 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 251 (N251Y)
Ref Sequence ENSEMBL: ENSMUSP00000071466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202636]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000071535
AA Change: N251Y

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: N251Y

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201148
AA Change: N251Y

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: N251Y

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202636
AA Change: N214Y

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144652
Gene: ENSMUSG00000068587
AA Change: N214Y

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Trefoil 28 70 3.6e-12 PFAM
Pfam:NtCtMGAM_N 87 196 1.4e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,425,756 D187E probably damaging Het
9530053A07Rik A G 7: 28,144,408 N907S probably benign Het
A830010M20Rik G T 5: 107,507,196 V954L probably benign Het
A830010M20Rik A G 5: 107,510,505 D1647G probably damaging Het
Abl2 T C 1: 156,630,060 Y299H probably damaging Het
Acsl3 T A 1: 78,681,992 N120K probably damaging Het
Aldh1a1 A G 19: 20,629,070 K255R possibly damaging Het
Baz2b C T 2: 59,920,437 R1205H probably benign Het
Carmil1 A G 13: 24,013,404 S1350P probably benign Het
Cecr2 A T 6: 120,761,621 N325I Het
Cep120 C T 18: 53,740,089 A57T probably damaging Het
Chst8 T C 7: 34,748,203 probably null Het
Cntn4 A T 6: 106,525,460 I393F probably damaging Het
Crocc T C 4: 141,022,341 D1494G probably damaging Het
Cwc25 T C 11: 97,748,006 E364G possibly damaging Het
Dnah7a C A 1: 53,684,900 probably null Het
Drg2 A G 11: 60,454,693 E5G probably benign Het
Ehd4 T C 2: 120,091,248 H509R probably damaging Het
Enam A T 5: 88,502,327 N565I probably damaging Het
Evi2a G T 11: 79,527,423 N120K probably benign Het
Faim A G 9: 98,992,126 T2A probably benign Het
Fmnl1 T C 11: 103,196,265 V836A unknown Het
Fosb T C 7: 19,305,188 I224V possibly damaging Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gm13103 A G 4: 143,851,881 N237S possibly damaging Het
Gm9972 G A 11: 43,036,804 G93R unknown Het
Gtf2a1 A T 12: 91,567,835 I215N possibly damaging Het
Hs3st3b1 A G 11: 63,921,571 V106A probably benign Het
Igkv19-93 T C 6: 68,736,501 D48G probably benign Het
Itgb8 A T 12: 119,237,708 W31R probably benign Het
Kmt2d A T 15: 98,854,104 W1995R unknown Het
Lama3 G T 18: 12,439,392 Q551H probably damaging Het
Lama5 T C 2: 180,201,795 Y453C probably damaging Het
Lbhd2 G A 12: 111,410,290 R57H probably damaging Het
Lcmt2 A G 2: 121,138,790 V384A probably damaging Het
Lgsn T G 1: 31,203,371 L178R probably damaging Het
Lhcgr C T 17: 88,758,383 V193I probably benign Het
Lta4h T C 10: 93,453,511 M1T probably null Het
Ly6l T C 15: 75,449,496 S14P probably damaging Het
Met C A 6: 17,547,012 C881* probably null Het
Mettl21e A T 1: 44,210,239 Y86N probably damaging Het
Mmp27 T A 9: 7,578,230 V357D probably damaging Het
Muc2 A G 7: 141,752,744 E740G Het
Myoc C A 1: 162,648,844 S372R probably benign Het
Ncor2 A T 5: 125,020,040 M1358K Het
Nol6 A G 4: 41,119,468 S613P probably benign Het
Nuggc T A 14: 65,617,623 I334N probably damaging Het
Nxnl2 C T 13: 51,171,506 P62S probably damaging Het
Ogfod1 C T 8: 94,037,439 H51Y possibly damaging Het
Olfml1 T A 7: 107,590,323 D198E possibly damaging Het
Olfr1395 A C 11: 49,149,118 N287T probably damaging Het
Ovch2 C T 7: 107,794,370 R183H possibly damaging Het
Plxnd1 A T 6: 115,960,837 L1516Q probably damaging Het
Prrc2c A G 1: 162,679,974 V2448A possibly damaging Het
Rexo5 C T 7: 119,818,413 T212I probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rnf213 T G 11: 119,437,992 I2030S Het
Rtf1 C T 2: 119,675,099 A11V unknown Het
Setdb1 T G 3: 95,338,674 T647P probably damaging Het
Shisa6 G C 11: 66,502,654 P272R possibly damaging Het
Slc25a54 G T 3: 109,116,501 G471* probably null Het
Slc30a1 A G 1: 191,909,432 T397A probably benign Het
Slc7a14 A G 3: 31,227,153 F336S possibly damaging Het
Slitrk3 C T 3: 73,050,465 V325I possibly damaging Het
Sptan1 A G 2: 29,986,929 Y361C probably damaging Het
Stard9 A G 2: 120,698,503 D1747G probably benign Het
Taf3 T C 2: 9,951,442 E638G probably damaging Het
Tbc1d8 T C 1: 39,372,533 D1074G probably benign Het
Tecrl G A 5: 83,354,907 H32Y probably benign Het
Tgm3 T A 2: 130,024,561 M133K probably benign Het
Tmem131 A G 1: 36,841,604 F195S probably damaging Het
Tmem82 T C 4: 141,614,950 I314V possibly damaging Het
Trappc10 T C 10: 78,207,493 E555G probably damaging Het
Ubn2 A T 6: 38,452,876 K176* probably null Het
Ucp1 G A 8: 83,293,902 G114R probably benign Het
Unc5c A G 3: 141,677,990 D43G probably damaging Het
Vmn2r3 C T 3: 64,261,404 V571M possibly damaging Het
Vwa3a A T 7: 120,786,465 I677L probably benign Het
Wdr48 T C 9: 119,911,081 S319P probably damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
BB002:Mgam UTSW 6 40759051 missense probably damaging 0.99
BB012:Mgam UTSW 6 40759051 missense probably damaging 0.99
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 splice site probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 splice site probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
R7525:Mgam UTSW 6 40766020 missense probably benign 0.01
R7530:Mgam UTSW 6 40709218 splice site probably null
R7570:Mgam UTSW 6 40746433 missense probably benign 0.16
R7669:Mgam UTSW 6 40659010 missense probably benign 0.00
R7679:Mgam UTSW 6 40643046 missense probably damaging 0.98
R7746:Mgam UTSW 6 40668193 missense probably damaging 0.99
R7859:Mgam UTSW 6 40740179 missense possibly damaging 0.75
R7925:Mgam UTSW 6 40759051 missense probably damaging 0.99
R8206:Mgam UTSW 6 40680235 missense probably benign 0.00
R8244:Mgam UTSW 6 40750586 missense probably damaging 1.00
R8309:Mgam UTSW 6 40745177 missense possibly damaging 0.88
R8472:Mgam UTSW 6 40694526 splice site probably null
R8758:Mgam UTSW 6 40729043 missense probably benign 0.41
R8777:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8777-TAIL:Mgam UTSW 6 40655251 missense probably damaging 0.97
R8783:Mgam UTSW 6 40656489 missense probably damaging 0.99
R8939:Mgam UTSW 6 40763203 critical splice donor site probably null
R8968:Mgam UTSW 6 40757811 critical splice acceptor site probably null
R8987:Mgam UTSW 6 40729636 missense probably damaging 1.00
R9055:Mgam UTSW 6 40714729 intron probably benign
R9171:Mgam UTSW 6 40768212 missense possibly damaging 0.76
R9252:Mgam UTSW 6 40729643 missense probably damaging 0.99
R9258:Mgam UTSW 6 40680187 missense probably benign
R9262:Mgam UTSW 6 40746488 critical splice donor site probably null
R9287:Mgam UTSW 6 40728971 intron probably benign
R9521:Mgam UTSW 6 40745184 missense probably damaging 1.00
R9589:Mgam UTSW 6 40750585 missense probably damaging 1.00
R9658:Mgam UTSW 6 40744377 missense possibly damaging 0.93
R9784:Mgam UTSW 6 40759090 missense probably damaging 1.00
RF011:Mgam UTSW 6 40757436 missense probably damaging 1.00
RF020:Mgam UTSW 6 40685309 missense probably damaging 1.00
RF023:Mgam UTSW 6 40680708 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Z1176:Mgam UTSW 6 40677644 critical splice donor site probably null
Z1176:Mgam UTSW 6 40729066 missense probably damaging 1.00
Z1177:Mgam UTSW 6 40740071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGAGTACTGAGTCTTTCTCTC -3'
(R):5'- CCCTTATCACCAGCTTCAAGG -3'

Sequencing Primer
(F):5'- AGAGTACTGAGTCTTTCTCTCCCTAC -3'
(R):5'- CAATTGTAGAACCCCAATGTGG -3'
Posted On 2019-06-26