Incidental Mutation 'R7282:Fosb'
ID 565728
Institutional Source Beutler Lab
Gene Symbol Fosb
Ensembl Gene ENSMUSG00000003545
Gene Name FBJ osteosarcoma oncogene B
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 19036621-19043970 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19039113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 224 (I224V)
Ref Sequence ENSEMBL: ENSMUSP00000003640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003640] [ENSMUST00000207334] [ENSMUST00000207716] [ENSMUST00000208326] [ENSMUST00000208446] [ENSMUST00000208505]
AlphaFold P13346
Predicted Effect possibly damaging
Transcript: ENSMUST00000003640
AA Change: I224V

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000003640
Gene: ENSMUSG00000003545
AA Change: I224V

DomainStartEndE-ValueType
low complexity region 113 132 N/A INTRINSIC
BRLZ 153 217 5.58e-13 SMART
low complexity region 255 265 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207334
AA Change: I188V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207716
AA Change: I149V

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000208326
AA Change: I185V

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208446
AA Change: I224V

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000208505
AA Change: I188V

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show impaired nurturing behavior, altered behavioral tolerance to repeated motor seizures, reduced NMDA-mediated synaptic currents, and altered paradoxical sleep. Aging mice homozygous for another null allele may exhibit occasional tonic-clonic or generalized seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,316,582 (GRCm39) D187E probably damaging Het
Abl2 T C 1: 156,457,630 (GRCm39) Y299H probably damaging Het
Acsl3 T A 1: 78,659,709 (GRCm39) N120K probably damaging Het
Aldh1a1 A G 19: 20,606,434 (GRCm39) K255R possibly damaging Het
Baz2b C T 2: 59,750,781 (GRCm39) R1205H probably benign Het
Btbd8 G T 5: 107,655,062 (GRCm39) V954L probably benign Het
Btbd8 A G 5: 107,658,371 (GRCm39) D1647G probably damaging Het
Carmil1 A G 13: 24,197,387 (GRCm39) S1350P probably benign Het
Cecr2 A T 6: 120,738,582 (GRCm39) N325I Het
Cep120 C T 18: 53,873,161 (GRCm39) A57T probably damaging Het
Chst8 T C 7: 34,447,628 (GRCm39) probably null Het
Cntn4 A T 6: 106,502,421 (GRCm39) I393F probably damaging Het
Crocc T C 4: 140,749,652 (GRCm39) D1494G probably damaging Het
Cwc25 T C 11: 97,638,832 (GRCm39) E364G possibly damaging Het
Dnah7a C A 1: 53,724,059 (GRCm39) probably null Het
Drg2 A G 11: 60,345,519 (GRCm39) E5G probably benign Het
Ehd4 T C 2: 119,921,729 (GRCm39) H509R probably damaging Het
Enam A T 5: 88,650,186 (GRCm39) N565I probably damaging Het
Evi2a G T 11: 79,418,249 (GRCm39) N120K probably benign Het
Faim A G 9: 98,874,179 (GRCm39) T2A probably benign Het
Fcgbpl1 A G 7: 27,843,833 (GRCm39) N907S probably benign Het
Fmnl1 T C 11: 103,087,091 (GRCm39) V836A unknown Het
Frem3 A T 8: 81,338,660 (GRCm39) T318S probably damaging Het
Gm9972 G A 11: 42,927,631 (GRCm39) G93R unknown Het
Gtf2a1 A T 12: 91,534,609 (GRCm39) I215N possibly damaging Het
Hs3st3b1 A G 11: 63,812,397 (GRCm39) V106A probably benign Het
Igkv19-93 T C 6: 68,713,485 (GRCm39) D48G probably benign Het
Itgb8 A T 12: 119,201,443 (GRCm39) W31R probably benign Het
Kmt2d A T 15: 98,751,985 (GRCm39) W1995R unknown Het
Lama3 G T 18: 12,572,449 (GRCm39) Q551H probably damaging Het
Lama5 T C 2: 179,843,588 (GRCm39) Y453C probably damaging Het
Lbhd2 G A 12: 111,376,724 (GRCm39) R57H probably damaging Het
Lcmt2 A G 2: 120,969,271 (GRCm39) V384A probably damaging Het
Lgsn T G 1: 31,242,452 (GRCm39) L178R probably damaging Het
Lhcgr C T 17: 89,065,811 (GRCm39) V193I probably benign Het
Lta4h T C 10: 93,289,373 (GRCm39) M1T probably null Het
Ly6l T C 15: 75,321,345 (GRCm39) S14P probably damaging Het
Met C A 6: 17,547,011 (GRCm39) C881* probably null Het
Mettl21e A T 1: 44,249,399 (GRCm39) Y86N probably damaging Het
Mgam A G 6: 40,740,045 (GRCm39) T1673A probably benign Het
Mgam A T 6: 40,633,446 (GRCm39) N251Y possibly damaging Het
Mmp27 T A 9: 7,578,231 (GRCm39) V357D probably damaging Het
Muc2 A G 7: 141,306,481 (GRCm39) E740G Het
Myoc C A 1: 162,476,413 (GRCm39) S372R probably benign Het
Ncor2 A T 5: 125,097,104 (GRCm39) M1358K Het
Nol6 A G 4: 41,119,468 (GRCm39) S613P probably benign Het
Nuggc T A 14: 65,855,072 (GRCm39) I334N probably damaging Het
Nxnl2 C T 13: 51,325,542 (GRCm39) P62S probably damaging Het
Ogfod1 C T 8: 94,764,067 (GRCm39) H51Y possibly damaging Het
Olfml1 T A 7: 107,189,530 (GRCm39) D198E possibly damaging Het
Or2t26 A C 11: 49,039,945 (GRCm39) N287T probably damaging Het
Ovch2 C T 7: 107,393,577 (GRCm39) R183H possibly damaging Het
Plxnd1 A T 6: 115,937,798 (GRCm39) L1516Q probably damaging Het
Pramel27 A G 4: 143,578,451 (GRCm39) N237S possibly damaging Het
Prrc2c A G 1: 162,507,543 (GRCm39) V2448A possibly damaging Het
Rexo5 C T 7: 119,417,636 (GRCm39) T212I probably damaging Het
Rgl2 C T 17: 34,152,403 (GRCm39) R367W probably damaging Het
Rnf213 T G 11: 119,328,818 (GRCm39) I2030S Het
Rtf1 C T 2: 119,505,580 (GRCm39) A11V unknown Het
Setdb1 T G 3: 95,245,985 (GRCm39) T647P probably damaging Het
Shisa6 G C 11: 66,393,480 (GRCm39) P272R possibly damaging Het
Slc25a54 G T 3: 109,023,817 (GRCm39) G471* probably null Het
Slc30a1 A G 1: 191,641,544 (GRCm39) T397A probably benign Het
Slc7a14 A G 3: 31,281,302 (GRCm39) F336S possibly damaging Het
Slitrk3 C T 3: 72,957,798 (GRCm39) V325I possibly damaging Het
Sptan1 A G 2: 29,876,941 (GRCm39) Y361C probably damaging Het
Stard9 A G 2: 120,528,984 (GRCm39) D1747G probably benign Het
Taf3 T C 2: 9,956,253 (GRCm39) E638G probably damaging Het
Tbc1d8 T C 1: 39,411,614 (GRCm39) D1074G probably benign Het
Tecrl G A 5: 83,502,754 (GRCm39) H32Y probably benign Het
Tgm3 T A 2: 129,866,481 (GRCm39) M133K probably benign Het
Tmem131 A G 1: 36,880,685 (GRCm39) F195S probably damaging Het
Tmem82 T C 4: 141,342,261 (GRCm39) I314V possibly damaging Het
Trappc10 T C 10: 78,043,327 (GRCm39) E555G probably damaging Het
Ubn2 A T 6: 38,429,811 (GRCm39) K176* probably null Het
Ucp1 G A 8: 84,020,531 (GRCm39) G114R probably benign Het
Unc5c A G 3: 141,383,751 (GRCm39) D43G probably damaging Het
Vmn2r3 C T 3: 64,168,825 (GRCm39) V571M possibly damaging Het
Vwa3a A T 7: 120,385,688 (GRCm39) I677L probably benign Het
Wdr48 T C 9: 119,740,147 (GRCm39) S319P probably damaging Het
Other mutations in Fosb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Fosb APN 7 19,041,039 (GRCm39) splice site probably null
R0183:Fosb UTSW 7 19,041,310 (GRCm39) missense probably damaging 0.99
R0374:Fosb UTSW 7 19,041,075 (GRCm39) missense probably damaging 0.99
R0555:Fosb UTSW 7 19,041,138 (GRCm39) missense possibly damaging 0.84
R2329:Fosb UTSW 7 19,041,110 (GRCm39) missense probably benign
R3498:Fosb UTSW 7 19,040,557 (GRCm39) missense probably damaging 1.00
R4064:Fosb UTSW 7 19,039,117 (GRCm39) nonsense probably null
R4790:Fosb UTSW 7 19,043,313 (GRCm39) missense probably damaging 1.00
R6327:Fosb UTSW 7 19,041,152 (GRCm39) missense probably benign
R6605:Fosb UTSW 7 19,043,283 (GRCm39) missense probably damaging 1.00
R7444:Fosb UTSW 7 19,041,199 (GRCm39) missense possibly damaging 0.86
R7764:Fosb UTSW 7 19,038,971 (GRCm39) missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGTACGAAGGGCTAACAACG -3'
(R):5'- GAAGCTACTCTGTGTGGTCG -3'

Sequencing Primer
(F):5'- CCGAGGACTTGAACTTCACTGTG -3'
(R):5'- CTACTCTGTGTGGTCGCTGAC -3'
Posted On 2019-06-26