Incidental Mutation 'R0584:Asxl2'
ID56573
Institutional Source Beutler Lab
Gene Symbol Asxl2
Ensembl Gene ENSMUSG00000037486
Gene Nameadditional sex combs like 2, transcriptional regulator
Synonyms
MMRRC Submission 038774-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R0584 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location3426857-3506852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3496632 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 472 (E472V)
Ref Sequence ENSEMBL: ENSMUSP00000106846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092003] [ENSMUST00000111215] [ENSMUST00000144247] [ENSMUST00000153102]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092003
AA Change: E472V

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089629
Gene: ENSMUSG00000037486
AA Change: E472V

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.2e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 1.2e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111215
AA Change: E472V

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106846
Gene: ENSMUSG00000037486
AA Change: E472V

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 3.6e-22 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 204 336 4.2e-52 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1305 1368 1.1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138740
SMART Domains Protein: ENSMUSP00000133639
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 1 54 1.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144247
SMART Domains Protein: ENSMUSP00000116048
Gene: ENSMUSG00000037486

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 5.2e-23 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
low complexity region 221 244 N/A INTRINSIC
Pfam:ASXH 252 384 7e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152196
Predicted Effect probably benign
Transcript: ENSMUST00000153102
AA Change: E472V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117384
Gene: ENSMUSG00000037486
AA Change: E472V

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-23 PFAM
low complexity region 95 122 N/A INTRINSIC
low complexity region 126 154 N/A INTRINSIC
low complexity region 162 185 N/A INTRINSIC
Pfam:ASXH 211 335 6.9e-38 PFAM
low complexity region 614 637 N/A INTRINSIC
low complexity region 640 658 N/A INTRINSIC
low complexity region 849 870 N/A INTRINSIC
low complexity region 1115 1124 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Pfam:PHD_3 1308 1368 7.6e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219208
Meta Mutation Damage Score 0.0670 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: This gene encodes a homolog of the Drosophila Asx gene, which interacts with genes involved in axial patterning. Mice with mutations in this gene display abnormal patterning of the axial skeleton, suggesting a similar function in mice as in Drosophila. This gene may also be involved in bone mineral density, specifically osteoclastogenesis. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a severe hypomorphic allele display prenatal and postnatal lethality, premature death, vertebral transformations and splitting, decreased body weight, enlarged hearts, and age-related cardiac interstitial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,011,730 S1745P probably damaging Het
Agfg2 G A 5: 137,667,730 T89I probably damaging Het
Agtr1a A G 13: 30,381,034 I27M probably damaging Het
Armh1 A T 4: 117,229,850 L206Q probably damaging Het
Atp2c2 T A 8: 119,738,418 V313E probably benign Het
Casp12 A G 9: 5,352,268 I87V probably null Het
Ccl25 C T 8: 4,354,085 probably benign Het
Col9a1 T C 1: 24,224,490 probably benign Het
Cyth4 A G 15: 78,609,878 probably null Het
Dnah9 A G 11: 65,990,489 Y2587H probably damaging Het
Dppa3 T C 6: 122,629,992 I147T probably benign Het
Fam120b T C 17: 15,402,122 S121P probably damaging Het
Fam209 C T 2: 172,474,161 T152M probably benign Het
Fam98a A G 17: 75,544,777 L103P probably damaging Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fitm1 T C 14: 55,576,656 V203A probably benign Het
Gcn1l1 G A 5: 115,595,015 R1037Q probably damaging Het
Gm11563 A G 11: 99,658,625 I101T unknown Het
Gpd1l A G 9: 114,914,344 F163L probably damaging Het
Grp C A 18: 65,873,695 A30E possibly damaging Het
H1fnt C A 15: 98,257,077 E64* probably null Het
Icosl T C 10: 78,071,875 Y90H possibly damaging Het
Itsn2 A G 12: 4,697,180 T1194A probably benign Het
Lrp6 A G 6: 134,456,076 S1431P probably damaging Het
Ltbp1 T C 17: 75,363,472 S1503P probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Myh13 G T 11: 67,360,374 E1360* probably null Het
Nop58 A G 1: 59,706,760 D400G probably benign Het
Olfr507 T C 7: 108,622,415 L201P probably benign Het
Olfr775 T C 10: 129,250,948 V138A probably benign Het
Oscp1 A G 4: 126,083,594 probably null Het
Pde9a A T 17: 31,459,977 Y264F probably damaging Het
Pkhd1 T A 1: 20,239,436 K2763* probably null Het
Prkci T A 3: 31,025,140 C42* probably null Het
Ptprr T C 10: 116,251,158 V270A probably damaging Het
Rsf1 T A 7: 97,662,128 N688K possibly damaging Het
S1pr3 A T 13: 51,419,661 M293L probably benign Het
Scn10a A C 9: 119,670,531 L232R probably damaging Het
Sirt5 T A 13: 43,394,728 probably null Het
Sp6 C T 11: 97,022,265 T268M probably damaging Het
Spag5 A G 11: 78,304,095 N76S possibly damaging Het
Tecta T C 9: 42,347,908 N1560D possibly damaging Het
Togaram1 T C 12: 64,967,505 L510P probably damaging Het
Umps A G 16: 33,959,124 I401T probably damaging Het
Vars2 A G 17: 35,666,686 V118A possibly damaging Het
Other mutations in Asxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Asxl2 APN 12 3474560 missense probably damaging 1.00
IGL01301:Asxl2 APN 12 3501425 missense probably damaging 1.00
IGL01325:Asxl2 APN 12 3427172 missense probably damaging 0.98
IGL01689:Asxl2 APN 12 3496425 missense probably benign 0.28
IGL01871:Asxl2 APN 12 3502112 missense probably benign 0.38
IGL02164:Asxl2 APN 12 3502079 missense probably benign 0.00
IGL02609:Asxl2 APN 12 3500018 missense probably damaging 1.00
IGL03191:Asxl2 APN 12 3500094 missense probably damaging 1.00
Blinder UTSW 12 3442529 missense probably damaging 0.99
Fob UTSW 12 3484531 missense probably damaging 1.00
peaky UTSW 12 3476040 missense possibly damaging 0.91
ANU18:Asxl2 UTSW 12 3501425 missense probably damaging 1.00
R0092:Asxl2 UTSW 12 3496313 missense probably benign 0.00
R0118:Asxl2 UTSW 12 3496923 missense probably damaging 1.00
R0277:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0323:Asxl2 UTSW 12 3442487 missense probably damaging 1.00
R0885:Asxl2 UTSW 12 3501458 missense probably damaging 1.00
R1344:Asxl2 UTSW 12 3493790 missense probably damaging 1.00
R1456:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R1829:Asxl2 UTSW 12 3457125 missense probably damaging 1.00
R1909:Asxl2 UTSW 12 3474577 missense probably damaging 1.00
R1990:Asxl2 UTSW 12 3484558 nonsense probably null
R2074:Asxl2 UTSW 12 3493779 missense probably damaging 1.00
R2883:Asxl2 UTSW 12 3501830 missense probably benign 0.03
R2912:Asxl2 UTSW 12 3474517 missense probably benign 0.06
R4446:Asxl2 UTSW 12 3501774 missense possibly damaging 0.54
R4662:Asxl2 UTSW 12 3427193 missense probably damaging 0.99
R4726:Asxl2 UTSW 12 3501872 missense possibly damaging 0.70
R5034:Asxl2 UTSW 12 3502193 missense probably damaging 0.98
R5287:Asxl2 UTSW 12 3496893 missense probably benign 0.02
R5377:Asxl2 UTSW 12 3474618 splice site probably null
R5611:Asxl2 UTSW 12 3484598 missense probably damaging 1.00
R5708:Asxl2 UTSW 12 3500603 missense possibly damaging 0.82
R5945:Asxl2 UTSW 12 3500439 missense possibly damaging 0.82
R6154:Asxl2 UTSW 12 3496593 missense possibly damaging 0.60
R6288:Asxl2 UTSW 12 3476040 missense possibly damaging 0.91
R6405:Asxl2 UTSW 12 3493758 missense probably damaging 0.99
R6938:Asxl2 UTSW 12 3476149 missense probably damaging 0.98
R7146:Asxl2 UTSW 12 3457066 missense probably damaging 1.00
R7354:Asxl2 UTSW 12 3455637 intron probably benign
R7396:Asxl2 UTSW 12 3442529 missense probably damaging 0.99
R7438:Asxl2 UTSW 12 3427108 start gained probably benign
R7980:Asxl2 UTSW 12 3496630 missense probably damaging 0.99
R7991:Asxl2 UTSW 12 3484531 missense probably damaging 1.00
R8063:Asxl2 UTSW 12 3500768 missense probably benign 0.01
R8156:Asxl2 UTSW 12 3496760 missense probably benign 0.09
R8396:Asxl2 UTSW 12 3502220 missense probably benign
R8773:Asxl2 UTSW 12 3457200 missense probably damaging 0.97
R8792:Asxl2 UTSW 12 3496536 missense probably benign 0.00
Z1177:Asxl2 UTSW 12 3474589 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATCCCCAGAACCTGTTCTTGCATC -3'
(R):5'- TGGGACTTTTCGCACTTGGACC -3'

Sequencing Primer
(F):5'- GTTGCCTGTGCTGAACAAGA -3'
(R):5'- GTCCCCTCTATTAAGAAAAGGCTG -3'
Posted On2013-07-11