Incidental Mutation 'R7282:Ovch2'
ID565732
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Nameovochymase 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7282 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location107781544-107801208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107794370 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 183 (R183H)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106755
AA Change: R183H

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: R183H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,425,756 D187E probably damaging Het
9530053A07Rik A G 7: 28,144,408 N907S probably benign Het
A830010M20Rik G T 5: 107,507,196 V954L probably benign Het
A830010M20Rik A G 5: 107,510,505 D1647G probably damaging Het
Abl2 T C 1: 156,630,060 Y299H probably damaging Het
Acsl3 T A 1: 78,681,992 N120K probably damaging Het
Aldh1a1 A G 19: 20,629,070 K255R possibly damaging Het
Baz2b C T 2: 59,920,437 R1205H probably benign Het
Carmil1 A G 13: 24,013,404 S1350P probably benign Het
Cecr2 A T 6: 120,761,621 N325I Het
Cep120 C T 18: 53,740,089 A57T probably damaging Het
Chst8 T C 7: 34,748,203 probably null Het
Cntn4 A T 6: 106,525,460 I393F probably damaging Het
Crocc T C 4: 141,022,341 D1494G probably damaging Het
Cwc25 T C 11: 97,748,006 E364G possibly damaging Het
Dnah7a C A 1: 53,684,900 probably null Het
Drg2 A G 11: 60,454,693 E5G probably benign Het
Ehd4 T C 2: 120,091,248 H509R probably damaging Het
Enam A T 5: 88,502,327 N565I probably damaging Het
Evi2a G T 11: 79,527,423 N120K probably benign Het
Faim A G 9: 98,992,126 T2A probably benign Het
Fmnl1 T C 11: 103,196,265 V836A unknown Het
Fosb T C 7: 19,305,188 I224V possibly damaging Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gm13103 A G 4: 143,851,881 N237S possibly damaging Het
Gm9972 G A 11: 43,036,804 G93R unknown Het
Gtf2a1 A T 12: 91,567,835 I215N possibly damaging Het
Hs3st3b1 A G 11: 63,921,571 V106A probably benign Het
Igkv19-93 T C 6: 68,736,501 D48G probably benign Het
Itgb8 A T 12: 119,237,708 W31R probably benign Het
Kmt2d A T 15: 98,854,104 W1995R unknown Het
Lama3 G T 18: 12,439,392 Q551H probably damaging Het
Lama5 T C 2: 180,201,795 Y453C probably damaging Het
Lbhd2 G A 12: 111,410,290 R57H probably damaging Het
Lcmt2 A G 2: 121,138,790 V384A probably damaging Het
Lgsn T G 1: 31,203,371 L178R probably damaging Het
Lhcgr C T 17: 88,758,383 V193I probably benign Het
Lta4h T C 10: 93,453,511 M1T probably null Het
Ly6l T C 15: 75,449,496 S14P probably damaging Het
Met C A 6: 17,547,012 C881* probably null Het
Mettl21e A T 1: 44,210,239 Y86N probably damaging Het
Mgam A T 6: 40,656,512 N251Y possibly damaging Het
Mgam A G 6: 40,763,111 T1673A probably benign Het
Mmp27 T A 9: 7,578,230 V357D probably damaging Het
Muc2 A G 7: 141,752,744 E740G Het
Myoc C A 1: 162,648,844 S372R probably benign Het
Ncor2 A T 5: 125,020,040 M1358K Het
Nol6 A G 4: 41,119,468 S613P probably benign Het
Nuggc T A 14: 65,617,623 I334N probably damaging Het
Nxnl2 C T 13: 51,171,506 P62S probably damaging Het
Ogfod1 C T 8: 94,037,439 H51Y possibly damaging Het
Olfml1 T A 7: 107,590,323 D198E possibly damaging Het
Olfr1395 A C 11: 49,149,118 N287T probably damaging Het
Plxnd1 A T 6: 115,960,837 L1516Q probably damaging Het
Prrc2c A G 1: 162,679,974 V2448A possibly damaging Het
Rexo5 C T 7: 119,818,413 T212I probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rnf213 T G 11: 119,437,992 I2030S Het
Rtf1 C T 2: 119,675,099 A11V unknown Het
Setdb1 T G 3: 95,338,674 T647P probably damaging Het
Shisa6 G C 11: 66,502,654 P272R possibly damaging Het
Slc25a54 G T 3: 109,116,501 G471* probably null Het
Slc30a1 A G 1: 191,909,432 T397A probably benign Het
Slc7a14 A G 3: 31,227,153 F336S possibly damaging Het
Slitrk3 C T 3: 73,050,465 V325I possibly damaging Het
Sptan1 A G 2: 29,986,929 Y361C probably damaging Het
Stard9 A G 2: 120,698,503 D1747G probably benign Het
Taf3 T C 2: 9,951,442 E638G probably damaging Het
Tbc1d8 T C 1: 39,372,533 D1074G probably benign Het
Tecrl G A 5: 83,354,907 H32Y probably benign Het
Tgm3 T A 2: 130,024,561 M133K probably benign Het
Tmem131 A G 1: 36,841,604 F195S probably damaging Het
Tmem82 T C 4: 141,614,950 I314V possibly damaging Het
Trappc10 T C 10: 78,207,493 E555G probably damaging Het
Ubn2 A T 6: 38,452,876 K176* probably null Het
Ucp1 G A 8: 83,293,902 G114R probably benign Het
Unc5c A G 3: 141,677,990 D43G probably damaging Het
Vmn2r3 C T 3: 64,261,404 V571M possibly damaging Het
Vwa3a A T 7: 120,786,465 I677L probably benign Het
Wdr48 T C 9: 119,911,081 S319P probably damaging Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107789090 missense probably null 1.00
IGL02198:Ovch2 APN 7 107794834 missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107794823 missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107796548 missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107790198 missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107794931 missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107801136 missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107782036 missense probably benign
R0631:Ovch2 UTSW 7 107782021 missense probably benign 0.01
R1028:Ovch2 UTSW 7 107796548 missense probably benign 0.37
R1329:Ovch2 UTSW 7 107785446 missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107790205 critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107790195 missense probably benign 0.02
R2265:Ovch2 UTSW 7 107784575 missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107794915 missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107785492 missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107796568 missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107796548 missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107792134 missense probably benign 0.26
R5353:Ovch2 UTSW 7 107794424 missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107793994 missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107793399 missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107781978 missense probably benign
R5979:Ovch2 UTSW 7 107794388 missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107796572 missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107785441 missense probably damaging 1.00
R6638:Ovch2 UTSW 7 107789094 missense probably benign 0.17
R6877:Ovch2 UTSW 7 107790108 missense probably benign 0.25
R7040:Ovch2 UTSW 7 107796565 missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107794433 missense probably damaging 1.00
R7824:Ovch2 UTSW 7 107789088 critical splice donor site probably null
R7841:Ovch2 UTSW 7 107794091 missense probably benign 0.01
R7908:Ovch2 UTSW 7 107789119 missense probably damaging 1.00
R8427:Ovch2 UTSW 7 107794000 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAGCTGGATGCAAGTTTG -3'
(R):5'- CAAGTGACCCCTGAAGATGC -3'

Sequencing Primer
(F):5'- CAGCTGGATGCAAGTTTGTGTCTC -3'
(R):5'- ATGCCAGGCTGATCCTTAAG -3'
Posted On2019-06-26