Incidental Mutation 'R7282:Drg2'
ID565747
Institutional Source Beutler Lab
Gene Symbol Drg2
Ensembl Gene ENSMUSG00000020537
Gene Namedevelopmentally regulated GTP binding protein 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R7282 (G1)
Quality Score195.009
Status Not validated
Chromosome11
Chromosomal Location60454591-60468754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60454693 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 5 (E5G)
Ref Sequence ENSEMBL: ENSMUSP00000018568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018568] [ENSMUST00000139477]
Predicted Effect probably benign
Transcript: ENSMUST00000018568
AA Change: E5G

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000018568
Gene: ENSMUSG00000020537
AA Change: E5G

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:FeoB_N 63 169 1.4e-10 PFAM
Pfam:MMR_HSR1 64 180 1.5e-19 PFAM
Pfam:MMR_HSR1_Xtn 184 289 9.6e-50 PFAM
Pfam:TGS 290 363 2.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139477
SMART Domains Protein: ENSMUSP00000135441
Gene: ENSMUSG00000018415

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Vac_ImportDeg 37 209 3.7e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTP-binding protein known to function in the regulation of cell growth and differentiation. Read-through transcripts containing this gene and a downstream gene have been identified, but they are not thought to encode a fusion protein. This gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,425,756 D187E probably damaging Het
9530053A07Rik A G 7: 28,144,408 N907S probably benign Het
A830010M20Rik G T 5: 107,507,196 V954L probably benign Het
A830010M20Rik A G 5: 107,510,505 D1647G probably damaging Het
Abl2 T C 1: 156,630,060 Y299H probably damaging Het
Acsl3 T A 1: 78,681,992 N120K probably damaging Het
Aldh1a1 A G 19: 20,629,070 K255R possibly damaging Het
Baz2b C T 2: 59,920,437 R1205H probably benign Het
Carmil1 A G 13: 24,013,404 S1350P probably benign Het
Cecr2 A T 6: 120,761,621 N325I Het
Cep120 C T 18: 53,740,089 A57T probably damaging Het
Chst8 T C 7: 34,748,203 probably null Het
Cntn4 A T 6: 106,525,460 I393F probably damaging Het
Crocc T C 4: 141,022,341 D1494G probably damaging Het
Cwc25 T C 11: 97,748,006 E364G possibly damaging Het
Dnah7a C A 1: 53,684,900 probably null Het
Ehd4 T C 2: 120,091,248 H509R probably damaging Het
Enam A T 5: 88,502,327 N565I probably damaging Het
Evi2a G T 11: 79,527,423 N120K probably benign Het
Faim A G 9: 98,992,126 T2A probably benign Het
Fmnl1 T C 11: 103,196,265 V836A unknown Het
Fosb T C 7: 19,305,188 I224V possibly damaging Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gm13103 A G 4: 143,851,881 N237S possibly damaging Het
Gm9972 G A 11: 43,036,804 G93R unknown Het
Gtf2a1 A T 12: 91,567,835 I215N possibly damaging Het
Hs3st3b1 A G 11: 63,921,571 V106A probably benign Het
Igkv19-93 T C 6: 68,736,501 D48G probably benign Het
Itgb8 A T 12: 119,237,708 W31R probably benign Het
Kmt2d A T 15: 98,854,104 W1995R unknown Het
Lama3 G T 18: 12,439,392 Q551H probably damaging Het
Lama5 T C 2: 180,201,795 Y453C probably damaging Het
Lbhd2 G A 12: 111,410,290 R57H probably damaging Het
Lcmt2 A G 2: 121,138,790 V384A probably damaging Het
Lgsn T G 1: 31,203,371 L178R probably damaging Het
Lhcgr C T 17: 88,758,383 V193I probably benign Het
Lta4h T C 10: 93,453,511 M1T probably null Het
Ly6l T C 15: 75,449,496 S14P probably damaging Het
Met C A 6: 17,547,012 C881* probably null Het
Mettl21e A T 1: 44,210,239 Y86N probably damaging Het
Mgam A T 6: 40,656,512 N251Y possibly damaging Het
Mgam A G 6: 40,763,111 T1673A probably benign Het
Mmp27 T A 9: 7,578,230 V357D probably damaging Het
Muc2 A G 7: 141,752,744 E740G Het
Myoc C A 1: 162,648,844 S372R probably benign Het
Ncor2 A T 5: 125,020,040 M1358K Het
Nol6 A G 4: 41,119,468 S613P probably benign Het
Nuggc T A 14: 65,617,623 I334N probably damaging Het
Nxnl2 C T 13: 51,171,506 P62S probably damaging Het
Ogfod1 C T 8: 94,037,439 H51Y possibly damaging Het
Olfml1 T A 7: 107,590,323 D198E possibly damaging Het
Olfr1395 A C 11: 49,149,118 N287T probably damaging Het
Ovch2 C T 7: 107,794,370 R183H possibly damaging Het
Plxnd1 A T 6: 115,960,837 L1516Q probably damaging Het
Prrc2c A G 1: 162,679,974 V2448A possibly damaging Het
Rexo5 C T 7: 119,818,413 T212I probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rnf213 T G 11: 119,437,992 I2030S Het
Rtf1 C T 2: 119,675,099 A11V unknown Het
Setdb1 T G 3: 95,338,674 T647P probably damaging Het
Shisa6 G C 11: 66,502,654 P272R possibly damaging Het
Slc25a54 G T 3: 109,116,501 G471* probably null Het
Slc30a1 A G 1: 191,909,432 T397A probably benign Het
Slc7a14 A G 3: 31,227,153 F336S possibly damaging Het
Slitrk3 C T 3: 73,050,465 V325I possibly damaging Het
Sptan1 A G 2: 29,986,929 Y361C probably damaging Het
Stard9 A G 2: 120,698,503 D1747G probably benign Het
Taf3 T C 2: 9,951,442 E638G probably damaging Het
Tbc1d8 T C 1: 39,372,533 D1074G probably benign Het
Tecrl G A 5: 83,354,907 H32Y probably benign Het
Tgm3 T A 2: 130,024,561 M133K probably benign Het
Tmem131 A G 1: 36,841,604 F195S probably damaging Het
Tmem82 T C 4: 141,614,950 I314V possibly damaging Het
Trappc10 T C 10: 78,207,493 E555G probably damaging Het
Ubn2 A T 6: 38,452,876 K176* probably null Het
Ucp1 G A 8: 83,293,902 G114R probably benign Het
Unc5c A G 3: 141,677,990 D43G probably damaging Het
Vmn2r3 C T 3: 64,261,404 V571M possibly damaging Het
Vwa3a A T 7: 120,786,465 I677L probably benign Het
Wdr48 T C 9: 119,911,081 S319P probably damaging Het
Other mutations in Drg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03019:Drg2 APN 11 60456595 missense probably damaging 1.00
R0356:Drg2 UTSW 11 60461581 missense probably damaging 0.97
R1483:Drg2 UTSW 11 60459527 missense probably damaging 1.00
R1501:Drg2 UTSW 11 60464853 missense probably benign 0.00
R2517:Drg2 UTSW 11 60468128 missense probably damaging 0.96
R3434:Drg2 UTSW 11 60461392 nonsense probably null
R3824:Drg2 UTSW 11 60459508 missense possibly damaging 0.85
R3825:Drg2 UTSW 11 60459508 missense possibly damaging 0.85
R3898:Drg2 UTSW 11 60456634 missense probably benign
R4418:Drg2 UTSW 11 60468146 missense probably damaging 1.00
R4732:Drg2 UTSW 11 60461396 critical splice donor site probably null
R4733:Drg2 UTSW 11 60461396 critical splice donor site probably null
R4953:Drg2 UTSW 11 60459436 splice site probably benign
R5492:Drg2 UTSW 11 60461596 missense probably damaging 0.99
R6007:Drg2 UTSW 11 60462625 missense possibly damaging 0.55
R7417:Drg2 UTSW 11 60454680 start codon destroyed probably null 0.77
Predicted Primers PCR Primer
(F):5'- ACGGATGGTATCTGCTCTCCAC -3'
(R):5'- AATCACGTCGCTGAATGTGC -3'

Sequencing Primer
(F):5'- GTATCTGCTCTCCACGTGGTG -3'
(R):5'- TGAATGTGCCCGCTCCC -3'
Posted On2019-06-26