Incidental Mutation 'R7282:Fmnl1'
ID 565752
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Name formin-like 1
Synonyms formin-related gene in leukocytes, 8030453N10Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.139) question?
Stock # R7282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 103061933-103089727 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103087091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 836 (V836A)
Ref Sequence ENSEMBL: ENSMUSP00000046296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021323] [ENSMUST00000042286] [ENSMUST00000107026] [ENSMUST00000107027] [ENSMUST00000129726] [ENSMUST00000172850] [ENSMUST00000174567] [ENSMUST00000218163]
AlphaFold Q9JL26
Predicted Effect probably benign
Transcript: ENSMUST00000021323
SMART Domains Protein: ENSMUSP00000021323
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 7.23e1 SMART
EFh 145 173 6.68e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000042286
AA Change: V836A
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805
AA Change: V836A

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107026
SMART Domains Protein: ENSMUSP00000102641
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 40 68 7.23e1 SMART
EFh 76 104 6.68e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107027
AA Change: V836A
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805
AA Change: V836A

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129726
SMART Domains Protein: ENSMUSP00000133299
Gene: ENSMUSG00000055805

DomainStartEndE-ValueType
Pfam:FH2 1 50 8.2e-10 PFAM
low complexity region 124 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172850
SMART Domains Protein: ENSMUSP00000139837
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
EFh 109 137 3.5e-1 SMART
EFh 145 173 3.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174567
SMART Domains Protein: ENSMUSP00000134292
Gene: ENSMUSG00000020940

DomainStartEndE-ValueType
SCOP:d1mr8a_ 153 209 5e-8 SMART
Blast:EFh 159 187 4e-12 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000218163
AA Change: V842A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,316,582 (GRCm39) D187E probably damaging Het
Abl2 T C 1: 156,457,630 (GRCm39) Y299H probably damaging Het
Acsl3 T A 1: 78,659,709 (GRCm39) N120K probably damaging Het
Aldh1a1 A G 19: 20,606,434 (GRCm39) K255R possibly damaging Het
Baz2b C T 2: 59,750,781 (GRCm39) R1205H probably benign Het
Btbd8 G T 5: 107,655,062 (GRCm39) V954L probably benign Het
Btbd8 A G 5: 107,658,371 (GRCm39) D1647G probably damaging Het
Carmil1 A G 13: 24,197,387 (GRCm39) S1350P probably benign Het
Cecr2 A T 6: 120,738,582 (GRCm39) N325I Het
Cep120 C T 18: 53,873,161 (GRCm39) A57T probably damaging Het
Chst8 T C 7: 34,447,628 (GRCm39) probably null Het
Cntn4 A T 6: 106,502,421 (GRCm39) I393F probably damaging Het
Crocc T C 4: 140,749,652 (GRCm39) D1494G probably damaging Het
Cwc25 T C 11: 97,638,832 (GRCm39) E364G possibly damaging Het
Dnah7a C A 1: 53,724,059 (GRCm39) probably null Het
Drg2 A G 11: 60,345,519 (GRCm39) E5G probably benign Het
Ehd4 T C 2: 119,921,729 (GRCm39) H509R probably damaging Het
Enam A T 5: 88,650,186 (GRCm39) N565I probably damaging Het
Evi2a G T 11: 79,418,249 (GRCm39) N120K probably benign Het
Faim A G 9: 98,874,179 (GRCm39) T2A probably benign Het
Fcgbpl1 A G 7: 27,843,833 (GRCm39) N907S probably benign Het
Fosb T C 7: 19,039,113 (GRCm39) I224V possibly damaging Het
Frem3 A T 8: 81,338,660 (GRCm39) T318S probably damaging Het
Gm9972 G A 11: 42,927,631 (GRCm39) G93R unknown Het
Gtf2a1 A T 12: 91,534,609 (GRCm39) I215N possibly damaging Het
Hs3st3b1 A G 11: 63,812,397 (GRCm39) V106A probably benign Het
Igkv19-93 T C 6: 68,713,485 (GRCm39) D48G probably benign Het
Itgb8 A T 12: 119,201,443 (GRCm39) W31R probably benign Het
Kmt2d A T 15: 98,751,985 (GRCm39) W1995R unknown Het
Lama3 G T 18: 12,572,449 (GRCm39) Q551H probably damaging Het
Lama5 T C 2: 179,843,588 (GRCm39) Y453C probably damaging Het
Lbhd2 G A 12: 111,376,724 (GRCm39) R57H probably damaging Het
Lcmt2 A G 2: 120,969,271 (GRCm39) V384A probably damaging Het
Lgsn T G 1: 31,242,452 (GRCm39) L178R probably damaging Het
Lhcgr C T 17: 89,065,811 (GRCm39) V193I probably benign Het
Lta4h T C 10: 93,289,373 (GRCm39) M1T probably null Het
Ly6l T C 15: 75,321,345 (GRCm39) S14P probably damaging Het
Met C A 6: 17,547,011 (GRCm39) C881* probably null Het
Mettl21e A T 1: 44,249,399 (GRCm39) Y86N probably damaging Het
Mgam A G 6: 40,740,045 (GRCm39) T1673A probably benign Het
Mgam A T 6: 40,633,446 (GRCm39) N251Y possibly damaging Het
Mmp27 T A 9: 7,578,231 (GRCm39) V357D probably damaging Het
Muc2 A G 7: 141,306,481 (GRCm39) E740G Het
Myoc C A 1: 162,476,413 (GRCm39) S372R probably benign Het
Ncor2 A T 5: 125,097,104 (GRCm39) M1358K Het
Nol6 A G 4: 41,119,468 (GRCm39) S613P probably benign Het
Nuggc T A 14: 65,855,072 (GRCm39) I334N probably damaging Het
Nxnl2 C T 13: 51,325,542 (GRCm39) P62S probably damaging Het
Ogfod1 C T 8: 94,764,067 (GRCm39) H51Y possibly damaging Het
Olfml1 T A 7: 107,189,530 (GRCm39) D198E possibly damaging Het
Or2t26 A C 11: 49,039,945 (GRCm39) N287T probably damaging Het
Ovch2 C T 7: 107,393,577 (GRCm39) R183H possibly damaging Het
Plxnd1 A T 6: 115,937,798 (GRCm39) L1516Q probably damaging Het
Pramel27 A G 4: 143,578,451 (GRCm39) N237S possibly damaging Het
Prrc2c A G 1: 162,507,543 (GRCm39) V2448A possibly damaging Het
Rexo5 C T 7: 119,417,636 (GRCm39) T212I probably damaging Het
Rgl2 C T 17: 34,152,403 (GRCm39) R367W probably damaging Het
Rnf213 T G 11: 119,328,818 (GRCm39) I2030S Het
Rtf1 C T 2: 119,505,580 (GRCm39) A11V unknown Het
Setdb1 T G 3: 95,245,985 (GRCm39) T647P probably damaging Het
Shisa6 G C 11: 66,393,480 (GRCm39) P272R possibly damaging Het
Slc25a54 G T 3: 109,023,817 (GRCm39) G471* probably null Het
Slc30a1 A G 1: 191,641,544 (GRCm39) T397A probably benign Het
Slc7a14 A G 3: 31,281,302 (GRCm39) F336S possibly damaging Het
Slitrk3 C T 3: 72,957,798 (GRCm39) V325I possibly damaging Het
Sptan1 A G 2: 29,876,941 (GRCm39) Y361C probably damaging Het
Stard9 A G 2: 120,528,984 (GRCm39) D1747G probably benign Het
Taf3 T C 2: 9,956,253 (GRCm39) E638G probably damaging Het
Tbc1d8 T C 1: 39,411,614 (GRCm39) D1074G probably benign Het
Tecrl G A 5: 83,502,754 (GRCm39) H32Y probably benign Het
Tgm3 T A 2: 129,866,481 (GRCm39) M133K probably benign Het
Tmem131 A G 1: 36,880,685 (GRCm39) F195S probably damaging Het
Tmem82 T C 4: 141,342,261 (GRCm39) I314V possibly damaging Het
Trappc10 T C 10: 78,043,327 (GRCm39) E555G probably damaging Het
Ubn2 A T 6: 38,429,811 (GRCm39) K176* probably null Het
Ucp1 G A 8: 84,020,531 (GRCm39) G114R probably benign Het
Unc5c A G 3: 141,383,751 (GRCm39) D43G probably damaging Het
Vmn2r3 C T 3: 64,168,825 (GRCm39) V571M possibly damaging Het
Vwa3a A T 7: 120,385,688 (GRCm39) I677L probably benign Het
Wdr48 T C 9: 119,740,147 (GRCm39) S319P probably damaging Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103,088,166 (GRCm39) nonsense probably null
IGL00972:Fmnl1 APN 11 103,071,781 (GRCm39) missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103,085,516 (GRCm39) unclassified probably benign
IGL01417:Fmnl1 APN 11 103,087,520 (GRCm39) unclassified probably benign
IGL01599:Fmnl1 APN 11 103,077,482 (GRCm39) missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103,083,598 (GRCm39) missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103,070,364 (GRCm39) missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103,087,592 (GRCm39) unclassified probably benign
IGL03369:Fmnl1 APN 11 103,088,008 (GRCm39) splice site probably null
archetypal UTSW 11 103,077,453 (GRCm39) missense probably damaging 1.00
contractual UTSW 11 103,071,741 (GRCm39) missense probably damaging 1.00
stylistic UTSW 11 103,084,562 (GRCm39) critical splice donor site probably null
R0077:Fmnl1 UTSW 11 103,080,795 (GRCm39) missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103,072,996 (GRCm39) critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103,072,996 (GRCm39) critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103,084,889 (GRCm39) splice site probably benign
R1170:Fmnl1 UTSW 11 103,088,196 (GRCm39) missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103,077,535 (GRCm39) splice site probably null
R1794:Fmnl1 UTSW 11 103,087,973 (GRCm39) missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103,082,851 (GRCm39) missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103,085,518 (GRCm39) missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103,085,591 (GRCm39) unclassified probably benign
R3883:Fmnl1 UTSW 11 103,072,940 (GRCm39) missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103,087,583 (GRCm39) unclassified probably benign
R4658:Fmnl1 UTSW 11 103,088,520 (GRCm39) missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103,084,562 (GRCm39) critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103,089,390 (GRCm39) unclassified probably benign
R4996:Fmnl1 UTSW 11 103,073,482 (GRCm39) missense possibly damaging 0.58
R5646:Fmnl1 UTSW 11 103,087,338 (GRCm39) unclassified probably benign
R5702:Fmnl1 UTSW 11 103,076,491 (GRCm39) missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103,086,111 (GRCm39) unclassified probably benign
R5903:Fmnl1 UTSW 11 103,062,270 (GRCm39) splice site probably null
R6254:Fmnl1 UTSW 11 103,087,141 (GRCm39) unclassified probably benign
R6958:Fmnl1 UTSW 11 103,062,140 (GRCm39) start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103,085,600 (GRCm39) unclassified probably benign
R7133:Fmnl1 UTSW 11 103,072,610 (GRCm39) critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103,081,224 (GRCm39) missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103,073,595 (GRCm39) critical splice donor site probably null
R7448:Fmnl1 UTSW 11 103,077,453 (GRCm39) missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103,083,954 (GRCm39) missense probably damaging 1.00
R7831:Fmnl1 UTSW 11 103,088,999 (GRCm39) missense unknown
R7862:Fmnl1 UTSW 11 103,071,756 (GRCm39) missense probably damaging 1.00
R7973:Fmnl1 UTSW 11 103,061,984 (GRCm39) start gained probably benign
R8177:Fmnl1 UTSW 11 103,080,785 (GRCm39) missense probably damaging 0.98
R8273:Fmnl1 UTSW 11 103,077,525 (GRCm39) missense probably damaging 1.00
R8345:Fmnl1 UTSW 11 103,077,440 (GRCm39) missense possibly damaging 0.88
R8507:Fmnl1 UTSW 11 103,084,859 (GRCm39) missense unknown
R8921:Fmnl1 UTSW 11 103,087,967 (GRCm39) missense unknown
R8946:Fmnl1 UTSW 11 103,071,741 (GRCm39) missense probably damaging 1.00
R8968:Fmnl1 UTSW 11 103,077,444 (GRCm39) small deletion probably benign
R9114:Fmnl1 UTSW 11 103,087,327 (GRCm39) missense unknown
R9696:Fmnl1 UTSW 11 103,086,297 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCCTGGAGTGGTCTAATGAAGG -3'
(R):5'- TCGACTTCATCTCCAACAACTG -3'

Sequencing Primer
(F):5'- CTAGTGTTAATAGTGTGCACATGAG -3'
(R):5'- TCCAACAACTGGGCAAGGATCTG -3'
Posted On 2019-06-26