Mutagenetix > Incidental Mutation

Incidental Mutation 'R7282:Rgl2'

565762

Institutional Source

Beutler Lab

Gene Symbol

Rgl2

Ensembl Gene

ENSMUSG00000041354

Gene Name

ral guanine nucleotide dissociation stimulator-like 2

Synonyms

KE1.5, Rab2l, Rgt2, Rlf

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R7282 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

33929543-33937687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 33933429 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 367 (R367W)

Ref Sequence

ENSEMBL: ENSMUSP00000041082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]

AlphaFold

Q61193

PDB Structure

STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025161

SMART Domains

Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	127	152	N/A	INTRINSIC
IG	168	292	3.45e0	SMART
IG_like	302	406	4.78e1	SMART
transmembrane domain	416	438	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000047503
AA Change: R367W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: R367W

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	31	42	N/A	INTRINSIC
low complexity region	44	63	N/A	INTRINSIC
RasGEFN	87	212	9.54e-30	SMART
RasGEF	239	514	7.15e-106	SMART
low complexity region	578	592	N/A	INTRINSIC
low complexity region	602	619	N/A	INTRINSIC
low complexity region	633	648	N/A	INTRINSIC
RA	649	736	2.05e-19	SMART
low complexity region	737	762	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173284

SMART Domains

Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

Domain	Start	End	E-Value	Type
Blast:RasGEF	2	67	1e-35	BLAST
PDB:4JGW\|B	2	67	1e-35	PDB
SCOP:d1bkds_	2	94	3e-16	SMART
low complexity region	131	145	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
RA	202	289	2.05e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810065E05Rik	C	A	11: 58,425,756	D187E	probably damaging	Het
9530053A07Rik	A	G	7: 28,144,408	N907S	probably benign	Het
A830010M20Rik	G	T	5: 107,507,196	V954L	probably benign	Het
A830010M20Rik	A	G	5: 107,510,505	D1647G	probably damaging	Het
Abl2	T	C	1: 156,630,060	Y299H	probably damaging	Het
Acsl3	T	A	1: 78,681,992	N120K	probably damaging	Het
Aldh1a1	A	G	19: 20,629,070	K255R	possibly damaging	Het
Baz2b	C	T	2: 59,920,437	R1205H	probably benign	Het
Carmil1	A	G	13: 24,013,404	S1350P	probably benign	Het
Cecr2	A	T	6: 120,761,621	N325I		Het
Cep120	C	T	18: 53,740,089	A57T	probably damaging	Het
Chst8	T	C	7: 34,748,203		probably null	Het
Cntn4	A	T	6: 106,525,460	I393F	probably damaging	Het
Crocc	T	C	4: 141,022,341	D1494G	probably damaging	Het
Cwc25	T	C	11: 97,748,006	E364G	possibly damaging	Het
Dnah7a	C	A	1: 53,684,900		probably null	Het
Drg2	A	G	11: 60,454,693	E5G	probably benign	Het
Ehd4	T	C	2: 120,091,248	H509R	probably damaging	Het
Enam	A	T	5: 88,502,327	N565I	probably damaging	Het
Evi2a	G	T	11: 79,527,423	N120K	probably benign	Het
Faim	A	G	9: 98,992,126	T2A	probably benign	Het
Fmnl1	T	C	11: 103,196,265	V836A	unknown	Het
Fosb	T	C	7: 19,305,188	I224V	possibly damaging	Het
Frem3	A	T	8: 80,612,031	T318S	probably damaging	Het
Gm13103	A	G	4: 143,851,881	N237S	possibly damaging	Het
Gm9972	G	A	11: 43,036,804	G93R	unknown	Het
Gtf2a1	A	T	12: 91,567,835	I215N	possibly damaging	Het
Hs3st3b1	A	G	11: 63,921,571	V106A	probably benign	Het
Igkv19-93	T	C	6: 68,736,501	D48G	probably benign	Het
Itgb8	A	T	12: 119,237,708	W31R	probably benign	Het
Kmt2d	A	T	15: 98,854,104	W1995R	unknown	Het
Lama3	G	T	18: 12,439,392	Q551H	probably damaging	Het
Lama5	T	C	2: 180,201,795	Y453C	probably damaging	Het
Lbhd2	G	A	12: 111,410,290	R57H	probably damaging	Het
Lcmt2	A	G	2: 121,138,790	V384A	probably damaging	Het
Lgsn	T	G	1: 31,203,371	L178R	probably damaging	Het
Lhcgr	C	T	17: 88,758,383	V193I	probably benign	Het
Lta4h	T	C	10: 93,453,511	M1T	probably null	Het
Ly6l	T	C	15: 75,449,496	S14P	probably damaging	Het
Met	C	A	6: 17,547,012	C881*	probably null	Het
Mettl21e	A	T	1: 44,210,239	Y86N	probably damaging	Het
Mgam	A	T	6: 40,656,512	N251Y	possibly damaging	Het
Mgam	A	G	6: 40,763,111	T1673A	probably benign	Het
Mmp27	T	A	9: 7,578,230	V357D	probably damaging	Het
Muc2	A	G	7: 141,752,744	E740G		Het
Myoc	C	A	1: 162,648,844	S372R	probably benign	Het
Ncor2	A	T	5: 125,020,040	M1358K		Het
Nol6	A	G	4: 41,119,468	S613P	probably benign	Het
Nuggc	T	A	14: 65,617,623	I334N	probably damaging	Het
Nxnl2	C	T	13: 51,171,506	P62S	probably damaging	Het
Ogfod1	C	T	8: 94,037,439	H51Y	possibly damaging	Het
Olfml1	T	A	7: 107,590,323	D198E	possibly damaging	Het
Olfr1395	A	C	11: 49,149,118	N287T	probably damaging	Het
Ovch2	C	T	7: 107,794,370	R183H	possibly damaging	Het
Plxnd1	A	T	6: 115,960,837	L1516Q	probably damaging	Het
Prrc2c	A	G	1: 162,679,974	V2448A	possibly damaging	Het
Rexo5	C	T	7: 119,818,413	T212I	probably damaging	Het
Rnf213	T	G	11: 119,437,992	I2030S		Het
Rtf1	C	T	2: 119,675,099	A11V	unknown	Het
Setdb1	T	G	3: 95,338,674	T647P	probably damaging	Het
Shisa6	G	C	11: 66,502,654	P272R	possibly damaging	Het
Slc25a54	G	T	3: 109,116,501	G471*	probably null	Het
Slc30a1	A	G	1: 191,909,432	T397A	probably benign	Het
Slc7a14	A	G	3: 31,227,153	F336S	possibly damaging	Het
Slitrk3	C	T	3: 73,050,465	V325I	possibly damaging	Het
Sptan1	A	G	2: 29,986,929	Y361C	probably damaging	Het
Stard9	A	G	2: 120,698,503	D1747G	probably benign	Het
Taf3	T	C	2: 9,951,442	E638G	probably damaging	Het
Tbc1d8	T	C	1: 39,372,533	D1074G	probably benign	Het
Tecrl	G	A	5: 83,354,907	H32Y	probably benign	Het
Tgm3	T	A	2: 130,024,561	M133K	probably benign	Het
Tmem131	A	G	1: 36,841,604	F195S	probably damaging	Het
Tmem82	T	C	4: 141,614,950	I314V	possibly damaging	Het
Trappc10	T	C	10: 78,207,493	E555G	probably damaging	Het
Ubn2	A	T	6: 38,452,876	K176*	probably null	Het
Ucp1	G	A	8: 83,293,902	G114R	probably benign	Het
Unc5c	A	G	3: 141,677,990	D43G	probably damaging	Het
Vmn2r3	C	T	3: 64,261,404	V571M	possibly damaging	Het
Vwa3a	A	T	7: 120,786,465	I677L	probably benign	Het
Wdr48	T	C	9: 119,911,081	S319P	probably damaging	Het

Other mutations in Rgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Rgl2	APN	17	33933136	missense	probably benign	0.31
IGL00898:Rgl2	APN	17	33933418	missense	possibly damaging	0.95
IGL00965:Rgl2	APN	17	33935936	missense	probably benign	0.00
IGL00985:Rgl2	APN	17	33932101	missense	probably damaging	1.00
IGL02140:Rgl2	APN	17	33933124	missense	probably damaging	1.00
IGL02214:Rgl2	APN	17	33935189	missense	probably benign	0.06
IGL02486:Rgl2	APN	17	33935980	missense	probably damaging	0.97
IGL02579:Rgl2	APN	17	33937160	missense	probably benign	0.08
IGL02976:Rgl2	APN	17	33933962	missense	possibly damaging	0.95
Hypotenuse	UTSW	17	33931739	missense	probably benign	0.00
Pedernales	UTSW	17	33932038	critical splice acceptor site	probably null
PIT4354001:Rgl2	UTSW	17	33933940	missense	possibly damaging	0.80
R0347:Rgl2	UTSW	17	33932738	missense	probably damaging	1.00
R0456:Rgl2	UTSW	17	33936849	splice site	probably null
R0825:Rgl2	UTSW	17	33935159	splice site	probably null
R1742:Rgl2	UTSW	17	33937223	splice site	probably null
R1777:Rgl2	UTSW	17	33931744	missense	probably benign	0.00
R1829:Rgl2	UTSW	17	33933621	missense	probably benign	0.00
R1908:Rgl2	UTSW	17	33932148	missense	probably benign	0.00
R1961:Rgl2	UTSW	17	33933615	missense	probably damaging	1.00
R2102:Rgl2	UTSW	17	33933340	splice site	probably null
R3001:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3002:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3755:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3756:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3978:Rgl2	UTSW	17	33935162	missense	probably benign	0.02
R4042:Rgl2	UTSW	17	33937262	missense	probably damaging	1.00
R4064:Rgl2	UTSW	17	33937108	missense	possibly damaging	0.77
R4204:Rgl2	UTSW	17	33936932	missense	probably benign	0.04
R4661:Rgl2	UTSW	17	33933226	missense	possibly damaging	0.77
R4852:Rgl2	UTSW	17	33937173	missense	probably benign	0.00
R4922:Rgl2	UTSW	17	33932775	unclassified	probably benign
R5119:Rgl2	UTSW	17	33937120	missense	probably benign	0.00
R5167:Rgl2	UTSW	17	33935974	nonsense	probably null
R5279:Rgl2	UTSW	17	33935948	missense	probably benign
R5319:Rgl2	UTSW	17	33933555	missense	probably benign	0.02
R5337:Rgl2	UTSW	17	33934984	missense	probably damaging	0.99
R5881:Rgl2	UTSW	17	33932717	missense	probably benign	0.01
R5945:Rgl2	UTSW	17	33932038	critical splice acceptor site	probably null
R6165:Rgl2	UTSW	17	33931765	missense	probably benign	0.01
R6358:Rgl2	UTSW	17	33937131	splice site	probably null
R6867:Rgl2	UTSW	17	33932687	missense	probably benign	0.09
R7174:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7182:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7183:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7184:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7196:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7203:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7250:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7253:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7254:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7255:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7256:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7455:Rgl2	UTSW	17	33932683	missense	probably benign	0.32
R7513:Rgl2	UTSW	17	33932555	missense	probably benign
R7752:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7901:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7941:Rgl2	UTSW	17	33931739	missense	probably benign	0.00
R8158:Rgl2	UTSW	17	33936944	missense	probably benign	0.27
R8209:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8226:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8405:Rgl2	UTSW	17	33933724	nonsense	probably null
R8871:Rgl2	UTSW	17	33935000	missense	probably damaging	1.00
R9205:Rgl2	UTSW	17	33936028	missense	probably damaging	1.00
R9591:Rgl2	UTSW	17	33932477	missense	possibly damaging	0.50
X0028:Rgl2	UTSW	17	33932458	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AGAGGTGACTGTGAGACCAC -3'
(R):5'- TGGGAATAATTATCCTCCTCTGAG -3'

Sequencing Primer
(F):5'- CTCCTAGAGAAGTGGATCCGTG -3'
(R):5'- ATCCTCCTCTGAGAAAATCTGGC -3'

Posted On

2019-06-26