Incidental Mutation 'R7282:Rgl2'
ID 565762
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R7282 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34152403 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 367 (R367W)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047503
AA Change: R367W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: R367W

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,316,582 (GRCm39) D187E probably damaging Het
Abl2 T C 1: 156,457,630 (GRCm39) Y299H probably damaging Het
Acsl3 T A 1: 78,659,709 (GRCm39) N120K probably damaging Het
Aldh1a1 A G 19: 20,606,434 (GRCm39) K255R possibly damaging Het
Baz2b C T 2: 59,750,781 (GRCm39) R1205H probably benign Het
Btbd8 G T 5: 107,655,062 (GRCm39) V954L probably benign Het
Btbd8 A G 5: 107,658,371 (GRCm39) D1647G probably damaging Het
Carmil1 A G 13: 24,197,387 (GRCm39) S1350P probably benign Het
Cecr2 A T 6: 120,738,582 (GRCm39) N325I Het
Cep120 C T 18: 53,873,161 (GRCm39) A57T probably damaging Het
Chst8 T C 7: 34,447,628 (GRCm39) probably null Het
Cntn4 A T 6: 106,502,421 (GRCm39) I393F probably damaging Het
Crocc T C 4: 140,749,652 (GRCm39) D1494G probably damaging Het
Cwc25 T C 11: 97,638,832 (GRCm39) E364G possibly damaging Het
Dnah7a C A 1: 53,724,059 (GRCm39) probably null Het
Drg2 A G 11: 60,345,519 (GRCm39) E5G probably benign Het
Ehd4 T C 2: 119,921,729 (GRCm39) H509R probably damaging Het
Enam A T 5: 88,650,186 (GRCm39) N565I probably damaging Het
Evi2a G T 11: 79,418,249 (GRCm39) N120K probably benign Het
Faim A G 9: 98,874,179 (GRCm39) T2A probably benign Het
Fcgbpl1 A G 7: 27,843,833 (GRCm39) N907S probably benign Het
Fmnl1 T C 11: 103,087,091 (GRCm39) V836A unknown Het
Fosb T C 7: 19,039,113 (GRCm39) I224V possibly damaging Het
Frem3 A T 8: 81,338,660 (GRCm39) T318S probably damaging Het
Gm9972 G A 11: 42,927,631 (GRCm39) G93R unknown Het
Gtf2a1 A T 12: 91,534,609 (GRCm39) I215N possibly damaging Het
Hs3st3b1 A G 11: 63,812,397 (GRCm39) V106A probably benign Het
Igkv19-93 T C 6: 68,713,485 (GRCm39) D48G probably benign Het
Itgb8 A T 12: 119,201,443 (GRCm39) W31R probably benign Het
Kmt2d A T 15: 98,751,985 (GRCm39) W1995R unknown Het
Lama3 G T 18: 12,572,449 (GRCm39) Q551H probably damaging Het
Lama5 T C 2: 179,843,588 (GRCm39) Y453C probably damaging Het
Lbhd2 G A 12: 111,376,724 (GRCm39) R57H probably damaging Het
Lcmt2 A G 2: 120,969,271 (GRCm39) V384A probably damaging Het
Lgsn T G 1: 31,242,452 (GRCm39) L178R probably damaging Het
Lhcgr C T 17: 89,065,811 (GRCm39) V193I probably benign Het
Lta4h T C 10: 93,289,373 (GRCm39) M1T probably null Het
Ly6l T C 15: 75,321,345 (GRCm39) S14P probably damaging Het
Met C A 6: 17,547,011 (GRCm39) C881* probably null Het
Mettl21e A T 1: 44,249,399 (GRCm39) Y86N probably damaging Het
Mgam A T 6: 40,633,446 (GRCm39) N251Y possibly damaging Het
Mgam A G 6: 40,740,045 (GRCm39) T1673A probably benign Het
Mmp27 T A 9: 7,578,231 (GRCm39) V357D probably damaging Het
Muc2 A G 7: 141,306,481 (GRCm39) E740G Het
Myoc C A 1: 162,476,413 (GRCm39) S372R probably benign Het
Ncor2 A T 5: 125,097,104 (GRCm39) M1358K Het
Nol6 A G 4: 41,119,468 (GRCm39) S613P probably benign Het
Nuggc T A 14: 65,855,072 (GRCm39) I334N probably damaging Het
Nxnl2 C T 13: 51,325,542 (GRCm39) P62S probably damaging Het
Ogfod1 C T 8: 94,764,067 (GRCm39) H51Y possibly damaging Het
Olfml1 T A 7: 107,189,530 (GRCm39) D198E possibly damaging Het
Or2t26 A C 11: 49,039,945 (GRCm39) N287T probably damaging Het
Ovch2 C T 7: 107,393,577 (GRCm39) R183H possibly damaging Het
Plxnd1 A T 6: 115,937,798 (GRCm39) L1516Q probably damaging Het
Pramel27 A G 4: 143,578,451 (GRCm39) N237S possibly damaging Het
Prrc2c A G 1: 162,507,543 (GRCm39) V2448A possibly damaging Het
Rexo5 C T 7: 119,417,636 (GRCm39) T212I probably damaging Het
Rnf213 T G 11: 119,328,818 (GRCm39) I2030S Het
Rtf1 C T 2: 119,505,580 (GRCm39) A11V unknown Het
Setdb1 T G 3: 95,245,985 (GRCm39) T647P probably damaging Het
Shisa6 G C 11: 66,393,480 (GRCm39) P272R possibly damaging Het
Slc25a54 G T 3: 109,023,817 (GRCm39) G471* probably null Het
Slc30a1 A G 1: 191,641,544 (GRCm39) T397A probably benign Het
Slc7a14 A G 3: 31,281,302 (GRCm39) F336S possibly damaging Het
Slitrk3 C T 3: 72,957,798 (GRCm39) V325I possibly damaging Het
Sptan1 A G 2: 29,876,941 (GRCm39) Y361C probably damaging Het
Stard9 A G 2: 120,528,984 (GRCm39) D1747G probably benign Het
Taf3 T C 2: 9,956,253 (GRCm39) E638G probably damaging Het
Tbc1d8 T C 1: 39,411,614 (GRCm39) D1074G probably benign Het
Tecrl G A 5: 83,502,754 (GRCm39) H32Y probably benign Het
Tgm3 T A 2: 129,866,481 (GRCm39) M133K probably benign Het
Tmem131 A G 1: 36,880,685 (GRCm39) F195S probably damaging Het
Tmem82 T C 4: 141,342,261 (GRCm39) I314V possibly damaging Het
Trappc10 T C 10: 78,043,327 (GRCm39) E555G probably damaging Het
Ubn2 A T 6: 38,429,811 (GRCm39) K176* probably null Het
Ucp1 G A 8: 84,020,531 (GRCm39) G114R probably benign Het
Unc5c A G 3: 141,383,751 (GRCm39) D43G probably damaging Het
Vmn2r3 C T 3: 64,168,825 (GRCm39) V571M possibly damaging Het
Vwa3a A T 7: 120,385,688 (GRCm39) I677L probably benign Het
Wdr48 T C 9: 119,740,147 (GRCm39) S319P probably damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4661:Rgl2 UTSW 17 34,152,200 (GRCm39) missense possibly damaging 0.77
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AGAGGTGACTGTGAGACCAC -3'
(R):5'- TGGGAATAATTATCCTCCTCTGAG -3'

Sequencing Primer
(F):5'- CTCCTAGAGAAGTGGATCCGTG -3'
(R):5'- ATCCTCCTCTGAGAAAATCTGGC -3'
Posted On 2019-06-26