Mutagenetix > Incidental Mutation

Incidental Mutation 'R7283:Ankrd44'

565768

Institutional Source

Beutler Lab

Gene Symbol

Ankrd44

Ensembl Gene

ENSMUSG00000052331

Gene Name

ankyrin repeat domain 44

Synonyms

E130014H08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R7283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

54645340-54926387 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 54729796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 465 (N465K)

Ref Sequence

ENSEMBL: ENSMUSP00000137616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044359] [ENSMUST00000178226] [ENSMUST00000179030]

AlphaFold

B2RXR6

Predicted Effect

probably damaging
Transcript: ENSMUST00000044359
AA Change: N483K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040327
Gene: ENSMUSG00000052331
AA Change: N483K

Domain	Start	End	E-Value	Type
ANK	7	36	2.55e2	SMART
ANK	40	69	3.23e-4	SMART
ANK	73	102	1.12e-3	SMART
ANK	106	135	1.65e-1	SMART
ANK	139	168	1.6e-8	SMART
ANK	172	201	4.97e-5	SMART
ANK	205	234	1.1e-6	SMART
ANK	238	267	9.7e-8	SMART
ANK	271	301	1.11e-2	SMART
ANK	305	334	9.35e-1	SMART
ANK	338	367	2.02e-5	SMART
ANK	371	400	5.98e1	SMART
ANK	422	451	7.13e-6	SMART
ANK	455	484	1.18e-6	SMART
ANK	488	545	1.17e2	SMART
ANK	549	579	3.31e-1	SMART
ANK	584	613	3.91e-3	SMART
ANK	617	646	1.43e-5	SMART
ANK	651	680	2.73e-2	SMART
ANK	687	716	5.41e-6	SMART
ANK	720	749	5.53e-3	SMART
ANK	753	785	1.52e0	SMART
ANK	789	819	9.27e-5	SMART
ANK	821	851	1.52e0	SMART
ANK	856	885	6.02e-4	SMART
ANK	889	919	3.08e-1	SMART
ANK	923	955	3.36e-2	SMART
ANK	959	988	6.26e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000178226
AA Change: N280K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000136802
Gene: ENSMUSG00000052331
AA Change: N280K

Domain	Start	End	E-Value	Type
ANK	2	31	1.1e-6	SMART
ANK	35	64	9.7e-8	SMART
ANK	68	98	1.11e-2	SMART
ANK	102	131	9.35e-1	SMART
ANK	135	164	2.02e-5	SMART
ANK	168	197	5.98e1	SMART
ANK	219	248	7.13e-6	SMART
ANK	252	281	1.18e-6	SMART
ANK	285	342	1.17e2	SMART
ANK	346	376	3.31e-1	SMART
ANK	381	410	3.91e-3	SMART
ANK	414	443	1.43e-5	SMART
ANK	448	477	2.73e-2	SMART
ANK	484	513	5.41e-6	SMART
ANK	517	546	5.53e-3	SMART
ANK	550	582	1.52e0	SMART
ANK	586	616	9.27e-5	SMART
ANK	618	648	1.52e0	SMART
ANK	653	682	6.02e-4	SMART
ANK	686	716	3.08e-1	SMART
ANK	720	752	3.36e-2	SMART
ANK	756	785	6.26e-2	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179030
AA Change: N465K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000137616
Gene: ENSMUSG00000052331
AA Change: N465K

Domain	Start	End	E-Value	Type
ANK	7	36	2.55e2	SMART
ANK	40	69	3.23e-4	SMART
ANK	73	102	1.12e-3	SMART
ANK	106	135	1.65e-1	SMART
ANK	139	168	1.6e-8	SMART
ANK	172	201	4.97e-5	SMART
ANK	205	234	1.1e-6	SMART
ANK	238	267	9.7e-8	SMART
ANK	271	301	1.11e-2	SMART
ANK	305	334	9.35e-1	SMART
ANK	338	367	2.02e-5	SMART
ANK	371	400	3.26e0	SMART
ANK	404	433	7.13e-6	SMART
ANK	437	466	1.18e-6	SMART
ANK	470	527	1.17e2	SMART
ANK	531	561	3.31e-1	SMART
ANK	566	595	3.91e-3	SMART
ANK	599	628	1.43e-5	SMART
ANK	633	662	2.73e-2	SMART
ANK	669	698	5.41e-6	SMART
ANK	702	731	5.53e-3	SMART
ANK	735	767	1.52e0	SMART
ANK	771	801	9.27e-5	SMART
ANK	803	833	1.52e0	SMART
ANK	838	867	6.02e-4	SMART
ANK	871	901	3.08e-1	SMART
ANK	905	937	3.36e-2	SMART
ANK	941	970	6.26e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (72/72)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,274,828	Q1346R	probably damaging	Het
4833439L19Rik	A	G	13: 54,552,691	V278A	probably benign	Het
4932415D10Rik	G	A	10: 82,291,297	R1960W	possibly damaging	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abce1	C	A	8: 79,685,256	G592*	probably null	Het
Acad10	A	C	5: 121,649,475	V137G	possibly damaging	Het
Adcy3	A	G	12: 4,203,563	I672V	not run	Het
Adgrb1	A	T	15: 74,580,663	Q1166L	possibly damaging	Het
Avpr1b	A	G	1: 131,609,731	T418A	probably benign	Het
Azin1	G	A	15: 38,501,408	T33I	probably damaging	Het
Bicra	T	C	7: 15,972,500	T1339A	probably damaging	Het
Cacna1s	A	G	1: 136,073,708	Y299C	probably damaging	Het
Clip1	A	C	5: 123,613,794	C641W		Het
Clip3	T	C	7: 30,305,812	S524P	probably damaging	Het
Cnpy4	A	T	5: 138,192,882	H240L	probably benign	Het
Cyp2b19	T	C	7: 26,766,914	Y381H	probably damaging	Het
Cyp3a13	T	A	5: 137,905,556	N280I	probably benign	Het
Diaph3	A	G	14: 86,866,584	F788S	probably damaging	Het
Drc7	A	G	8: 95,071,579	N484S	probably damaging	Het
Erap1	G	A	13: 74,673,784		probably null	Het
Fat4	A	T	3: 38,889,693	I912F	probably damaging	Het
Hsd3b3	T	A	3: 98,742,357	K217*	probably null	Het
Igkv12-89	A	G	6: 68,835,077	V36A	probably damaging	Het
Invs	T	A	4: 48,392,526		probably null	Het
Ipo8	T	A	6: 148,824,481	Y30F	possibly damaging	Het
Kctd14	T	C	7: 97,451,486	M1T	probably null	Het
Klrb1c	A	T	6: 128,784,257	C136S	probably benign	Het
Morn2	A	G	17: 80,297,259	E48G	probably damaging	Het
Myh1	A	T	11: 67,201,844		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nfxl1	A	G	5: 72,529,050	S603P	probably benign	Het
Nlrc3	G	A	16: 3,947,877	A351V	probably benign	Het
Nlrp4f	G	A	13: 65,195,538	R76*	probably null	Het
Olfr190	A	T	16: 59,074,192	M296K	probably benign	Het
Olfr228	A	T	2: 86,483,139	I201N	probably damaging	Het
Olfr397	T	C	11: 73,964,808	S67P	probably damaging	Het
Olfr664	G	T	7: 104,733,593	T257K	probably damaging	Het
Olfr872	A	C	9: 20,260,259	I140L	probably damaging	Het
Papolg	A	G	11: 23,867,394	V601A	not run	Het
Pde4dip	T	C	3: 97,758,882	T349A	probably benign	Het
Pdlim5	T	C	3: 142,311,980		probably null	Het
Pkhd1l1	A	G	15: 44,503,280	N718S	probably benign	Het
Plcxd3	A	G	15: 4,516,919	H135R	probably damaging	Het
Plxna2	A	T	1: 194,644,883	Y375F	probably damaging	Het
Prkca	C	T	11: 108,340,645		probably null	Het
Prkdc	A	G	16: 15,717,764	S1663G	probably benign	Het
Ptbp3	T	C	4: 59,514,384	T80A	probably benign	Het
Ptpn4	C	T	1: 119,682,531	V696I	possibly damaging	Het
Pygl	A	T	12: 70,216,568	W175R	possibly damaging	Het
Rftn1	A	G	17: 50,047,441	Y298H	probably damaging	Het
Rit2	A	G	18: 31,316,839		probably null	Het
Runx1t1	G	A	4: 13,846,935	G240R	probably damaging	Het
Scn10a	A	G	9: 119,664,779		probably null	Het
Serpina16	A	C	12: 103,672,432		probably null	Het
Slc17a3	A	T	13: 23,855,848	M290L		Het
Slc6a4	A	T	11: 77,010,696	M86L	probably benign	Het
Spag7	A	T	11: 70,665,313	V46E	probably benign	Het
Sptlc1	T	C	13: 53,344,878	I271V	probably benign	Het
Stk17b	A	C	1: 53,757,515	H364Q	probably benign	Het
Strc	T	C	2: 121,379,452	H130R	probably damaging	Het
Stxbp1	T	A	2: 32,815,014	D148V	probably damaging	Het
Tirap	G	A	9: 35,188,929	P153L	probably damaging	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tmem51	T	A	4: 142,031,783	D218V	probably damaging	Het
Trim40	A	T	17: 36,882,662	D218E	probably benign	Het
Ttc21b	T	C	2: 66,208,718	D934G	probably damaging	Het
Vmn2r26	T	C	6: 124,025,955	L108P	probably damaging	Het
Washc2	C	A	6: 116,227,418	P429Q	probably damaging	Het
Wipi1	A	G	11: 109,611,311	M1T	probably null	Het
Zfp438	A	G	18: 5,214,712	V82A	probably damaging	Het
Zfp853	G	C	5: 143,287,738	A724G	unknown	Het

Other mutations in Ankrd44

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00578:Ankrd44	APN	1	54662647	splice site	probably benign
IGL00839:Ankrd44	APN	1	54667435	missense	probably benign	0.27
IGL01145:Ankrd44	APN	1	54762259	critical splice donor site	probably null
IGL01380:Ankrd44	APN	1	54727565	missense	probably benign	0.00
IGL01415:Ankrd44	APN	1	54752928	missense	probably damaging	1.00
IGL01958:Ankrd44	APN	1	54766966	missense	probably damaging	0.99
IGL02014:Ankrd44	APN	1	54657620	missense	possibly damaging	0.95
IGL02745:Ankrd44	APN	1	54766791	missense	probably damaging	1.00
IGL03008:Ankrd44	APN	1	54766809	missense	probably damaging	1.00
wilderness	UTSW	1	54735034	synonymous	silent
PIT4812001:Ankrd44	UTSW	1	54723038	nonsense	probably null
R0416:Ankrd44	UTSW	1	54743339	missense	possibly damaging	0.63
R0554:Ankrd44	UTSW	1	54763758	missense	probably benign	0.00
R0575:Ankrd44	UTSW	1	54762310	missense	probably damaging	1.00
R1323:Ankrd44	UTSW	1	54766450	splice site	probably benign
R1605:Ankrd44	UTSW	1	54828622	missense	probably benign	0.36
R2032:Ankrd44	UTSW	1	54723009	splice site	probably null
R4458:Ankrd44	UTSW	1	54762391	missense	possibly damaging	0.92
R4610:Ankrd44	UTSW	1	54766748	intron	probably benign
R4727:Ankrd44	UTSW	1	54667417	missense	probably benign	0.05
R4780:Ankrd44	UTSW	1	54763757	missense	probably benign	0.00
R4801:Ankrd44	UTSW	1	54762316	missense	probably damaging	1.00
R4802:Ankrd44	UTSW	1	54762316	missense	probably damaging	1.00
R4810:Ankrd44	UTSW	1	54735143	intron	probably benign
R4961:Ankrd44	UTSW	1	54663912	missense	probably damaging	1.00
R5053:Ankrd44	UTSW	1	54735089	nonsense	probably null
R5093:Ankrd44	UTSW	1	54763718	missense	probably damaging	1.00
R5155:Ankrd44	UTSW	1	54778330	missense	probably benign	0.43
R5248:Ankrd44	UTSW	1	54667380	missense	probably damaging	1.00
R5306:Ankrd44	UTSW	1	54926203	utr 5 prime	probably benign
R5595:Ankrd44	UTSW	1	54735050	missense	probably damaging	1.00
R5595:Ankrd44	UTSW	1	54762347	missense	probably damaging	1.00
R6288:Ankrd44	UTSW	1	54763763	missense	probably damaging	1.00
R6332:Ankrd44	UTSW	1	54762273	missense	probably damaging	1.00
R6453:Ankrd44	UTSW	1	54657704	splice site	probably null
R6610:Ankrd44	UTSW	1	54655087	missense	probably benign	0.02
R6699:Ankrd44	UTSW	1	54762445	missense	probably damaging	1.00
R6905:Ankrd44	UTSW	1	54792494	missense	probably damaging	1.00
R7173:Ankrd44	UTSW	1	54766391	missense	probably damaging	1.00
R7178:Ankrd44	UTSW	1	54649440	missense
R7219:Ankrd44	UTSW	1	54766910	missense	probably damaging	1.00
R7276:Ankrd44	UTSW	1	54735080	missense	probably benign	0.05
R7414:Ankrd44	UTSW	1	54667380	missense	probably damaging	1.00
R7490:Ankrd44	UTSW	1	54648300	missense	probably benign	0.03
R7501:Ankrd44	UTSW	1	54649363	missense
R7515:Ankrd44	UTSW	1	54766355	missense	probably damaging	1.00
R7527:Ankrd44	UTSW	1	54648324	missense	probably benign	0.08
R7807:Ankrd44	UTSW	1	54792476	missense	probably damaging	1.00
R8164:Ankrd44	UTSW	1	54663979	missense	probably damaging	1.00
R8247:Ankrd44	UTSW	1	54752943	missense	probably damaging	1.00
R8408:Ankrd44	UTSW	1	54723098	missense	probably benign	0.00
R8859:Ankrd44	UTSW	1	54667521	missense	possibly damaging	0.94
R8963:Ankrd44	UTSW	1	54762379	missense	probably damaging	1.00
R8971:Ankrd44	UTSW	1	54653793	missense	probably benign	0.01
R8987:Ankrd44	UTSW	1	54661190	nonsense	probably null
R9354:Ankrd44	UTSW	1	54648279	makesense	probably null
RF021:Ankrd44	UTSW	1	54778312	missense	probably damaging	1.00
Z1088:Ankrd44	UTSW	1	54658982	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGAATGAGAGATTCCTTGTGTGC -3'
(R):5'- CTTTGCGGACTCAGCTTTGC -3'

Sequencing Primer
(F):5'- GCAGTTTCTAGGAGGCAGTATG -3'
(R):5'- CCATTGCACTATGCAGCT -3'

Posted On

2019-06-26