Incidental Mutation 'R0584:Sirt5'
ID56577
Institutional Source Beutler Lab
Gene Symbol Sirt5
Ensembl Gene ENSMUSG00000054021
Gene Namesirtuin 5
Synonyms1500032M05Rik, 0610012J09Rik
MMRRC Submission 038774-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0584 (G1)
Quality Score135
Status Validated
Chromosome13
Chromosomal Location43365496-43395203 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 43394728 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066804] [ENSMUST00000066804] [ENSMUST00000071926] [ENSMUST00000222499] [ENSMUST00000223194]
Predicted Effect probably null
Transcript: ENSMUST00000066804
SMART Domains Protein: ENSMUSP00000071048
Gene: ENSMUSG00000054021

DomainStartEndE-ValueType
Pfam:SIR2 58 256 5.3e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000066804
SMART Domains Protein: ENSMUSP00000071048
Gene: ENSMUSG00000054021

DomainStartEndE-ValueType
Pfam:SIR2 58 256 5.3e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000071926
SMART Domains Protein: ENSMUSP00000071818
Gene: ENSMUSG00000063200

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
Pfam:NUC129 167 229 1.1e-34 PFAM
low complexity region 236 251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220997
Predicted Effect probably null
Transcript: ENSMUST00000222499
Predicted Effect probably null
Transcript: ENSMUST00000223194
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class III of the sirtuin family. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly healthy and do not exhibit globally increased mitochondrial protein acetylation levels relative to wild-type controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,011,730 S1745P probably damaging Het
Agfg2 G A 5: 137,667,730 T89I probably damaging Het
Agtr1a A G 13: 30,381,034 I27M probably damaging Het
Armh1 A T 4: 117,229,850 L206Q probably damaging Het
Asxl2 A T 12: 3,496,632 E472V probably damaging Het
Atp2c2 T A 8: 119,738,418 V313E probably benign Het
Casp12 A G 9: 5,352,268 I87V probably null Het
Ccl25 C T 8: 4,354,085 probably benign Het
Col9a1 T C 1: 24,224,490 probably benign Het
Cyth4 A G 15: 78,609,878 probably null Het
Dnah9 A G 11: 65,990,489 Y2587H probably damaging Het
Dppa3 T C 6: 122,629,992 I147T probably benign Het
Fam120b T C 17: 15,402,122 S121P probably damaging Het
Fam209 C T 2: 172,474,161 T152M probably benign Het
Fam98a A G 17: 75,544,777 L103P probably damaging Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fitm1 T C 14: 55,576,656 V203A probably benign Het
Gcn1l1 G A 5: 115,595,015 R1037Q probably damaging Het
Gm11563 A G 11: 99,658,625 I101T unknown Het
Gpd1l A G 9: 114,914,344 F163L probably damaging Het
Grp C A 18: 65,873,695 A30E possibly damaging Het
H1fnt C A 15: 98,257,077 E64* probably null Het
Icosl T C 10: 78,071,875 Y90H possibly damaging Het
Itsn2 A G 12: 4,697,180 T1194A probably benign Het
Lrp6 A G 6: 134,456,076 S1431P probably damaging Het
Ltbp1 T C 17: 75,363,472 S1503P probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Myh13 G T 11: 67,360,374 E1360* probably null Het
Nop58 A G 1: 59,706,760 D400G probably benign Het
Olfr507 T C 7: 108,622,415 L201P probably benign Het
Olfr775 T C 10: 129,250,948 V138A probably benign Het
Oscp1 A G 4: 126,083,594 probably null Het
Pde9a A T 17: 31,459,977 Y264F probably damaging Het
Pkhd1 T A 1: 20,239,436 K2763* probably null Het
Prkci T A 3: 31,025,140 C42* probably null Het
Ptprr T C 10: 116,251,158 V270A probably damaging Het
Rsf1 T A 7: 97,662,128 N688K possibly damaging Het
S1pr3 A T 13: 51,419,661 M293L probably benign Het
Scn10a A C 9: 119,670,531 L232R probably damaging Het
Sp6 C T 11: 97,022,265 T268M probably damaging Het
Spag5 A G 11: 78,304,095 N76S possibly damaging Het
Tecta T C 9: 42,347,908 N1560D possibly damaging Het
Togaram1 T C 12: 64,967,505 L510P probably damaging Het
Umps A G 16: 33,959,124 I401T probably damaging Het
Vars2 A G 17: 35,666,686 V118A possibly damaging Het
Other mutations in Sirt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02321:Sirt5 APN 13 43379688 missense probably damaging 1.00
R0697:Sirt5 UTSW 13 43385576 missense probably damaging 1.00
R1022:Sirt5 UTSW 13 43370769 missense probably benign 0.05
R1024:Sirt5 UTSW 13 43370769 missense probably benign 0.05
R1352:Sirt5 UTSW 13 43394807 missense probably damaging 1.00
R1874:Sirt5 UTSW 13 43370791 missense possibly damaging 0.92
R3552:Sirt5 UTSW 13 43383167 missense probably damaging 1.00
R3778:Sirt5 UTSW 13 43383107 critical splice acceptor site probably null
R5591:Sirt5 UTSW 13 43371841 missense possibly damaging 0.67
R7188:Sirt5 UTSW 13 43371904 missense possibly damaging 0.93
R7788:Sirt5 UTSW 13 43383147 missense probably benign 0.43
R8063:Sirt5 UTSW 13 43370847 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCCTTATGAATAGACACCCAGACTT -3'
(R):5'- AGTGCCCTGCTTTAGCACTCCA -3'

Sequencing Primer
(F):5'- tcaaaccaccacacacacc -3'
(R):5'- GCTTTAGCACTCCAGGATACCG -3'
Posted On2013-07-11