Incidental Mutation 'R7283:Ptpn4'
ID 565770
Institutional Source Beutler Lab
Gene Symbol Ptpn4
Ensembl Gene ENSMUSG00000026384
Gene Name protein tyrosine phosphatase, non-receptor type 4
Synonyms TEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.271) question?
Stock # R7283 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 119652467-119837613 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119682531 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 696 (V696I)
Ref Sequence ENSEMBL: ENSMUSP00000067614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000166624]
AlphaFold Q9WU22
Predicted Effect possibly damaging
Transcript: ENSMUST00000064091
AA Change: V696I

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: V696I

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDZ 526 605 2.47e-14 SMART
PTPc 654 913 1.38e-120 SMART
Predicted Effect silent
Transcript: ENSMUST00000166624
SMART Domains Protein: ENSMUSP00000126216
Gene: ENSMUSG00000026384

DomainStartEndE-ValueType
Blast:PTPc 1 65 1e-34 BLAST
PDB:2I75|A 15 67 2e-28 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,274,828 Q1346R probably damaging Het
4833439L19Rik A G 13: 54,552,691 V278A probably benign Het
4932415D10Rik G A 10: 82,291,297 R1960W possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abce1 C A 8: 79,685,256 G592* probably null Het
Acad10 A C 5: 121,649,475 V137G possibly damaging Het
Adcy3 A G 12: 4,203,563 I672V not run Het
Adgrb1 A T 15: 74,580,663 Q1166L possibly damaging Het
Ankrd44 A T 1: 54,729,796 N465K probably damaging Het
Avpr1b A G 1: 131,609,731 T418A probably benign Het
Azin1 G A 15: 38,501,408 T33I probably damaging Het
Bicra T C 7: 15,972,500 T1339A probably damaging Het
Cacna1s A G 1: 136,073,708 Y299C probably damaging Het
Clip1 A C 5: 123,613,794 C641W Het
Clip3 T C 7: 30,305,812 S524P probably damaging Het
Cnpy4 A T 5: 138,192,882 H240L probably benign Het
Cyp2b19 T C 7: 26,766,914 Y381H probably damaging Het
Cyp3a13 T A 5: 137,905,556 N280I probably benign Het
Diaph3 A G 14: 86,866,584 F788S probably damaging Het
Drc7 A G 8: 95,071,579 N484S probably damaging Het
Erap1 G A 13: 74,673,784 probably null Het
Fat4 A T 3: 38,889,693 I912F probably damaging Het
Hsd3b3 T A 3: 98,742,357 K217* probably null Het
Igkv12-89 A G 6: 68,835,077 V36A probably damaging Het
Invs T A 4: 48,392,526 probably null Het
Ipo8 T A 6: 148,824,481 Y30F possibly damaging Het
Kctd14 T C 7: 97,451,486 M1T probably null Het
Klrb1c A T 6: 128,784,257 C136S probably benign Het
Morn2 A G 17: 80,297,259 E48G probably damaging Het
Myh1 A T 11: 67,201,844 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfxl1 A G 5: 72,529,050 S603P probably benign Het
Nlrc3 G A 16: 3,947,877 A351V probably benign Het
Nlrp4f G A 13: 65,195,538 R76* probably null Het
Olfr190 A T 16: 59,074,192 M296K probably benign Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr397 T C 11: 73,964,808 S67P probably damaging Het
Olfr664 G T 7: 104,733,593 T257K probably damaging Het
Olfr872 A C 9: 20,260,259 I140L probably damaging Het
Papolg A G 11: 23,867,394 V601A not run Het
Pde4dip T C 3: 97,758,882 T349A probably benign Het
Pdlim5 T C 3: 142,311,980 probably null Het
Pkhd1l1 A G 15: 44,503,280 N718S probably benign Het
Plcxd3 A G 15: 4,516,919 H135R probably damaging Het
Plxna2 A T 1: 194,644,883 Y375F probably damaging Het
Prkca C T 11: 108,340,645 probably null Het
Prkdc A G 16: 15,717,764 S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 T80A probably benign Het
Pygl A T 12: 70,216,568 W175R possibly damaging Het
Rftn1 A G 17: 50,047,441 Y298H probably damaging Het
Rit2 A G 18: 31,316,839 probably null Het
Runx1t1 G A 4: 13,846,935 G240R probably damaging Het
Scn10a A G 9: 119,664,779 probably null Het
Serpina16 A C 12: 103,672,432 probably null Het
Slc17a3 A T 13: 23,855,848 M290L Het
Slc6a4 A T 11: 77,010,696 M86L probably benign Het
Spag7 A T 11: 70,665,313 V46E probably benign Het
Sptlc1 T C 13: 53,344,878 I271V probably benign Het
Stk17b A C 1: 53,757,515 H364Q probably benign Het
Strc T C 2: 121,379,452 H130R probably damaging Het
Stxbp1 T A 2: 32,815,014 D148V probably damaging Het
Tirap G A 9: 35,188,929 P153L probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem51 T A 4: 142,031,783 D218V probably damaging Het
Trim40 A T 17: 36,882,662 D218E probably benign Het
Ttc21b T C 2: 66,208,718 D934G probably damaging Het
Vmn2r26 T C 6: 124,025,955 L108P probably damaging Het
Washc2 C A 6: 116,227,418 P429Q probably damaging Het
Wipi1 A G 11: 109,611,311 M1T probably null Het
Zfp438 A G 18: 5,214,712 V82A probably damaging Het
Zfp853 G C 5: 143,287,738 A724G unknown Het
Other mutations in Ptpn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ptpn4 APN 1 119659925 splice site probably benign
IGL00885:Ptpn4 APN 1 119802363 missense possibly damaging 0.95
IGL00973:Ptpn4 APN 1 119741371 missense probably benign 0.00
IGL01867:Ptpn4 APN 1 119675599 missense probably benign
IGL01870:Ptpn4 APN 1 119675547 critical splice donor site probably null
IGL02101:Ptpn4 APN 1 119687678 missense probably damaging 1.00
IGL02344:Ptpn4 APN 1 119773260 missense probably damaging 1.00
IGL02348:Ptpn4 APN 1 119682722 missense probably damaging 1.00
IGL02693:Ptpn4 APN 1 119715969 missense probably damaging 0.96
IGL03281:Ptpn4 APN 1 119659912 missense probably damaging 1.00
alto UTSW 1 119684581 nonsense probably null
blinding UTSW 1 119721862 critical splice donor site probably null
botched UTSW 1 119743390 missense probably damaging 1.00
bungled UTSW 1 119687605 splice site probably null
Fovea UTSW 1 119678822 missense possibly damaging 0.81
hash UTSW 1 119765919 nonsense probably null
Hoechter UTSW 1 119680059 missense probably damaging 1.00
Lumens UTSW 1 119667548 missense probably damaging 1.00
BB008:Ptpn4 UTSW 1 119680195 missense probably damaging 0.98
BB018:Ptpn4 UTSW 1 119680195 missense probably damaging 0.98
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0504:Ptpn4 UTSW 1 119765915 missense probably damaging 1.00
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119675709 splice site probably benign
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1662:Ptpn4 UTSW 1 119765058 missense probably damaging 0.96
R1694:Ptpn4 UTSW 1 119783510 missense probably damaging 0.99
R1733:Ptpn4 UTSW 1 119716043 splice site probably null
R2083:Ptpn4 UTSW 1 119687759 missense possibly damaging 0.63
R2226:Ptpn4 UTSW 1 119682785 missense probably damaging 1.00
R2276:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R2277:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R3123:Ptpn4 UTSW 1 119765423 splice site probably null
R3425:Ptpn4 UTSW 1 119707830 missense probably benign 0.02
R4568:Ptpn4 UTSW 1 119680059 missense probably damaging 1.00
R4716:Ptpn4 UTSW 1 119721868 missense probably damaging 1.00
R4819:Ptpn4 UTSW 1 119659850 missense probably benign
R4959:Ptpn4 UTSW 1 119765096 nonsense probably null
R5161:Ptpn4 UTSW 1 119707863 nonsense probably null
R5345:Ptpn4 UTSW 1 119765477 missense probably benign
R5471:Ptpn4 UTSW 1 119765919 nonsense probably null
R5826:Ptpn4 UTSW 1 119684516 missense probably benign 0.32
R5933:Ptpn4 UTSW 1 119687723 missense probably damaging 0.97
R6075:Ptpn4 UTSW 1 119765136 missense probably damaging 1.00
R6286:Ptpn4 UTSW 1 119721862 critical splice donor site probably null
R6389:Ptpn4 UTSW 1 119721954 missense probably damaging 0.97
R6392:Ptpn4 UTSW 1 119773123 missense probably benign
R6769:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6771:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6794:Ptpn4 UTSW 1 119743390 missense probably damaging 1.00
R6933:Ptpn4 UTSW 1 119773148 intron probably benign
R6967:Ptpn4 UTSW 1 119684581 nonsense probably null
R6980:Ptpn4 UTSW 1 119743421 missense possibly damaging 0.86
R7150:Ptpn4 UTSW 1 119691745 critical splice donor site probably null
R7247:Ptpn4 UTSW 1 119690034 makesense probably null
R7459:Ptpn4 UTSW 1 119659834 missense probably damaging 0.99
R7732:Ptpn4 UTSW 1 119692802 missense probably benign
R7794:Ptpn4 UTSW 1 119726037 missense probably damaging 1.00
R8061:Ptpn4 UTSW 1 119691600 critical splice donor site probably null
R8236:Ptpn4 UTSW 1 119678822 missense possibly damaging 0.81
R8929:Ptpn4 UTSW 1 119667548 missense probably damaging 1.00
R8979:Ptpn4 UTSW 1 119743390 missense probably damaging 1.00
R9334:Ptpn4 UTSW 1 119802384 missense probably benign
RF014:Ptpn4 UTSW 1 119684465 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTGCTTTGCCATCTCTCTAGC -3'
(R):5'- GCCAAATTACCTCAGAACATTTCC -3'

Sequencing Primer
(F):5'- GCAATGTTATTCACCATGGAGAG -3'
(R):5'- AACAGATACAGAGATATTTCACCTTG -3'
Posted On 2019-06-26