Incidental Mutation 'R7283:Ptpn4'
ID 565770
Institutional Source Beutler Lab
Gene Symbol Ptpn4
Ensembl Gene ENSMUSG00000026384
Gene Name protein tyrosine phosphatase, non-receptor type 4
Synonyms testis-enriched phosphatase, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte), hPTP-MEG, TEP, PTPMEG, TEP/mPTPMEG
MMRRC Submission 045361-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.291) question?
Stock # R7283 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 119580197-119765281 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119610261 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 696 (V696I)
Ref Sequence ENSEMBL: ENSMUSP00000067614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000166624]
AlphaFold Q9WU22
Predicted Effect possibly damaging
Transcript: ENSMUST00000064091
AA Change: V696I

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: V696I

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDZ 526 605 2.47e-14 SMART
PTPc 654 913 1.38e-120 SMART
Predicted Effect silent
Transcript: ENSMUST00000166624
SMART Domains Protein: ENSMUSP00000126216
Gene: ENSMUSG00000026384

DomainStartEndE-ValueType
Blast:PTPc 1 65 1e-34 BLAST
PDB:2I75|A 15 67 2e-28 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,700,504 (GRCm39) V278A probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abce1 C A 8: 80,411,885 (GRCm39) G592* probably null Het
Acad10 A C 5: 121,787,538 (GRCm39) V137G possibly damaging Het
Adcy3 A G 12: 4,253,563 (GRCm39) I672V not run Het
Adgrb1 A T 15: 74,452,512 (GRCm39) Q1166L possibly damaging Het
Ankrd44 A T 1: 54,768,955 (GRCm39) N465K probably damaging Het
Avpr1b A G 1: 131,537,469 (GRCm39) T418A probably benign Het
Azin1 G A 15: 38,501,652 (GRCm39) T33I probably damaging Het
Bicra T C 7: 15,706,425 (GRCm39) T1339A probably damaging Het
Bltp2 A G 11: 78,165,654 (GRCm39) Q1346R probably damaging Het
Cacna1s A G 1: 136,001,446 (GRCm39) Y299C probably damaging Het
Clip1 A C 5: 123,751,857 (GRCm39) C641W Het
Clip3 T C 7: 30,005,237 (GRCm39) S524P probably damaging Het
Cnpy4 A T 5: 138,191,144 (GRCm39) H240L probably benign Het
Cyp2b19 T C 7: 26,466,339 (GRCm39) Y381H probably damaging Het
Cyp3a13 T A 5: 137,903,818 (GRCm39) N280I probably benign Het
Diaph3 A G 14: 87,104,020 (GRCm39) F788S probably damaging Het
Drc7 A G 8: 95,798,207 (GRCm39) N484S probably damaging Het
Erap1 G A 13: 74,821,903 (GRCm39) probably null Het
Fat4 A T 3: 38,943,842 (GRCm39) I912F probably damaging Het
Hsd3b3 T A 3: 98,649,673 (GRCm39) K217* probably null Het
Igkv12-89 A G 6: 68,812,061 (GRCm39) V36A probably damaging Het
Invs T A 4: 48,392,526 (GRCm39) probably null Het
Ipo8 T A 6: 148,725,979 (GRCm39) Y30F possibly damaging Het
Kctd14 T C 7: 97,100,693 (GRCm39) M1T probably null Het
Klrb1c A T 6: 128,761,220 (GRCm39) C136S probably benign Het
Morn2 A G 17: 80,604,688 (GRCm39) E48G probably damaging Het
Myh1 A T 11: 67,092,670 (GRCm39) probably null Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nfxl1 A G 5: 72,686,393 (GRCm39) S603P probably benign Het
Nlrc3 G A 16: 3,765,741 (GRCm39) A351V probably benign Het
Nlrp4f G A 13: 65,343,352 (GRCm39) R76* probably null Het
Or1e1f T C 11: 73,855,634 (GRCm39) S67P probably damaging Het
Or52n1 G T 7: 104,382,800 (GRCm39) T257K probably damaging Het
Or5h22 A T 16: 58,894,555 (GRCm39) M296K probably benign Het
Or7e176 A C 9: 20,171,555 (GRCm39) I140L probably damaging Het
Or8k41 A T 2: 86,313,483 (GRCm39) I201N probably damaging Het
Papolg A G 11: 23,817,394 (GRCm39) V601A not run Het
Pde4dip T C 3: 97,666,198 (GRCm39) T349A probably benign Het
Pdlim5 T C 3: 142,017,741 (GRCm39) probably null Het
Pkhd1l1 A G 15: 44,366,676 (GRCm39) N718S probably benign Het
Plcxd3 A G 15: 4,546,401 (GRCm39) H135R probably damaging Het
Plxna2 A T 1: 194,327,191 (GRCm39) Y375F probably damaging Het
Prkca C T 11: 108,231,471 (GRCm39) probably null Het
Prkdc A G 16: 15,535,628 (GRCm39) S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 (GRCm39) T80A probably benign Het
Pygl A T 12: 70,263,342 (GRCm39) W175R possibly damaging Het
Rftn1 A G 17: 50,354,469 (GRCm39) Y298H probably damaging Het
Rit2 A G 18: 31,449,892 (GRCm39) probably null Het
Runx1t1 G A 4: 13,846,935 (GRCm39) G240R probably damaging Het
Scn10a A G 9: 119,493,845 (GRCm39) probably null Het
Serpina16 A C 12: 103,638,691 (GRCm39) probably null Het
Slc17a3 A T 13: 24,039,831 (GRCm39) M290L Het
Slc6a4 A T 11: 76,901,522 (GRCm39) M86L probably benign Het
Spag7 A T 11: 70,556,139 (GRCm39) V46E probably benign Het
Spata31h1 G A 10: 82,127,131 (GRCm39) R1960W possibly damaging Het
Sptlc1 T C 13: 53,498,914 (GRCm39) I271V probably benign Het
Stk17b A C 1: 53,796,674 (GRCm39) H364Q probably benign Het
Strc T C 2: 121,209,933 (GRCm39) H130R probably damaging Het
Stxbp1 T A 2: 32,705,026 (GRCm39) D148V probably damaging Het
Tirap G A 9: 35,100,225 (GRCm39) P153L probably damaging Het
Tmco3 G A 8: 13,369,605 (GRCm39) probably null Het
Tmem51 T A 4: 141,759,094 (GRCm39) D218V probably damaging Het
Trim40 A T 17: 37,193,554 (GRCm39) D218E probably benign Het
Ttc21b T C 2: 66,039,062 (GRCm39) D934G probably damaging Het
Vmn2r26 T C 6: 124,002,914 (GRCm39) L108P probably damaging Het
Washc2 C A 6: 116,204,379 (GRCm39) P429Q probably damaging Het
Wipi1 A G 11: 109,502,137 (GRCm39) M1T probably null Het
Zfp438 A G 18: 5,214,712 (GRCm39) V82A probably damaging Het
Zfp853 G C 5: 143,273,493 (GRCm39) A724G unknown Het
Other mutations in Ptpn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ptpn4 APN 1 119,587,655 (GRCm39) splice site probably benign
IGL00885:Ptpn4 APN 1 119,730,093 (GRCm39) missense possibly damaging 0.95
IGL00973:Ptpn4 APN 1 119,669,101 (GRCm39) missense probably benign 0.00
IGL01867:Ptpn4 APN 1 119,603,329 (GRCm39) missense probably benign
IGL01870:Ptpn4 APN 1 119,603,277 (GRCm39) critical splice donor site probably null
IGL02101:Ptpn4 APN 1 119,615,408 (GRCm39) missense probably damaging 1.00
IGL02344:Ptpn4 APN 1 119,700,990 (GRCm39) missense probably damaging 1.00
IGL02348:Ptpn4 APN 1 119,610,452 (GRCm39) missense probably damaging 1.00
IGL02693:Ptpn4 APN 1 119,643,699 (GRCm39) missense probably damaging 0.96
IGL03281:Ptpn4 APN 1 119,587,642 (GRCm39) missense probably damaging 1.00
alto UTSW 1 119,612,311 (GRCm39) nonsense probably null
blinding UTSW 1 119,649,592 (GRCm39) critical splice donor site probably null
botched UTSW 1 119,671,120 (GRCm39) missense probably damaging 1.00
bungled UTSW 1 119,615,335 (GRCm39) splice site probably null
Fovea UTSW 1 119,606,552 (GRCm39) missense possibly damaging 0.81
hash UTSW 1 119,693,649 (GRCm39) nonsense probably null
Hoechter UTSW 1 119,607,789 (GRCm39) missense probably damaging 1.00
Lumens UTSW 1 119,595,278 (GRCm39) missense probably damaging 1.00
BB008:Ptpn4 UTSW 1 119,607,925 (GRCm39) missense probably damaging 0.98
BB018:Ptpn4 UTSW 1 119,607,925 (GRCm39) missense probably damaging 0.98
R0105:Ptpn4 UTSW 1 119,615,335 (GRCm39) splice site probably null
R0105:Ptpn4 UTSW 1 119,615,335 (GRCm39) splice site probably null
R0504:Ptpn4 UTSW 1 119,693,645 (GRCm39) missense probably damaging 1.00
R1148:Ptpn4 UTSW 1 119,612,270 (GRCm39) missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119,612,270 (GRCm39) missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119,603,439 (GRCm39) splice site probably benign
R1662:Ptpn4 UTSW 1 119,692,788 (GRCm39) missense probably damaging 0.96
R1694:Ptpn4 UTSW 1 119,711,240 (GRCm39) missense probably damaging 0.99
R1733:Ptpn4 UTSW 1 119,643,773 (GRCm39) splice site probably null
R2083:Ptpn4 UTSW 1 119,615,489 (GRCm39) missense possibly damaging 0.63
R2226:Ptpn4 UTSW 1 119,610,515 (GRCm39) missense probably damaging 1.00
R2276:Ptpn4 UTSW 1 119,612,321 (GRCm39) missense probably damaging 1.00
R2277:Ptpn4 UTSW 1 119,612,321 (GRCm39) missense probably damaging 1.00
R3123:Ptpn4 UTSW 1 119,693,153 (GRCm39) splice site probably null
R3425:Ptpn4 UTSW 1 119,635,560 (GRCm39) missense probably benign 0.02
R4568:Ptpn4 UTSW 1 119,607,789 (GRCm39) missense probably damaging 1.00
R4716:Ptpn4 UTSW 1 119,649,598 (GRCm39) missense probably damaging 1.00
R4819:Ptpn4 UTSW 1 119,587,580 (GRCm39) missense probably benign
R4959:Ptpn4 UTSW 1 119,692,826 (GRCm39) nonsense probably null
R5161:Ptpn4 UTSW 1 119,635,593 (GRCm39) nonsense probably null
R5345:Ptpn4 UTSW 1 119,693,207 (GRCm39) missense probably benign
R5471:Ptpn4 UTSW 1 119,693,649 (GRCm39) nonsense probably null
R5826:Ptpn4 UTSW 1 119,612,246 (GRCm39) missense probably benign 0.32
R5933:Ptpn4 UTSW 1 119,615,453 (GRCm39) missense probably damaging 0.97
R6075:Ptpn4 UTSW 1 119,692,866 (GRCm39) missense probably damaging 1.00
R6286:Ptpn4 UTSW 1 119,649,592 (GRCm39) critical splice donor site probably null
R6389:Ptpn4 UTSW 1 119,649,684 (GRCm39) missense probably damaging 0.97
R6392:Ptpn4 UTSW 1 119,700,853 (GRCm39) missense probably benign
R6769:Ptpn4 UTSW 1 119,643,698 (GRCm39) missense probably benign 0.01
R6771:Ptpn4 UTSW 1 119,643,698 (GRCm39) missense probably benign 0.01
R6794:Ptpn4 UTSW 1 119,671,120 (GRCm39) missense probably damaging 1.00
R6933:Ptpn4 UTSW 1 119,700,878 (GRCm39) intron probably benign
R6967:Ptpn4 UTSW 1 119,612,311 (GRCm39) nonsense probably null
R6980:Ptpn4 UTSW 1 119,671,151 (GRCm39) missense possibly damaging 0.86
R7150:Ptpn4 UTSW 1 119,619,475 (GRCm39) critical splice donor site probably null
R7247:Ptpn4 UTSW 1 119,617,764 (GRCm39) makesense probably null
R7459:Ptpn4 UTSW 1 119,587,564 (GRCm39) missense probably damaging 0.99
R7732:Ptpn4 UTSW 1 119,620,532 (GRCm39) missense probably benign
R7794:Ptpn4 UTSW 1 119,653,767 (GRCm39) missense probably damaging 1.00
R8061:Ptpn4 UTSW 1 119,619,330 (GRCm39) critical splice donor site probably null
R8236:Ptpn4 UTSW 1 119,606,552 (GRCm39) missense possibly damaging 0.81
R8929:Ptpn4 UTSW 1 119,595,278 (GRCm39) missense probably damaging 1.00
R8979:Ptpn4 UTSW 1 119,671,120 (GRCm39) missense probably damaging 1.00
R9334:Ptpn4 UTSW 1 119,730,114 (GRCm39) missense probably benign
RF014:Ptpn4 UTSW 1 119,612,195 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTGCTTTGCCATCTCTCTAGC -3'
(R):5'- GCCAAATTACCTCAGAACATTTCC -3'

Sequencing Primer
(F):5'- GCAATGTTATTCACCATGGAGAG -3'
(R):5'- AACAGATACAGAGATATTTCACCTTG -3'
Posted On 2019-06-26