Mutagenetix > Incidental Mutation

Incidental Mutation 'R7283:Cacna1s'

565772

Institutional Source

Beutler Lab

Gene Symbol

Cacna1s

Ensembl Gene

ENSMUSG00000026407

Gene Name

calcium channel, voltage-dependent, L type, alpha 1S subunit

Synonyms

sj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd

MMRRC Submission

Accession Numbers

Genbank: NM_001081023; MGI: 88294

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

136052750-136119822 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 136073708 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 299 (Y299C)

Ref Sequence

ENSEMBL: ENSMUSP00000107699 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000112064
AA Change: Y299C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: Y299C

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	50	345	4.3e-68	PFAM
Pfam:Ion_trans	431	672	4.5e-56	PFAM
Pfam:PKD_channel	516	667	1.9e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
Pfam:Ion_trans	798	1076	2.6e-65	PFAM
Pfam:Ion_trans	1117	1392	1.2e-71	PFAM
Pfam:PKD_channel	1126	1387	8.4e-13	PFAM
Pfam:GPHH	1394	1463	2.3e-38	PFAM
Ca_chan_IQ	1515	1548	3.71e-14	SMART
low complexity region	1657	1669	N/A	INTRINSIC
Pfam:CAC1F_C	1756	1845	2.8e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112068
AA Change: Y299C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: Y299C

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	88	333	9.1e-57	PFAM
PDB:4DEY\|B	334	417	1e-20	PDB
Pfam:Ion_trans	466	660	3.7e-46	PFAM
Pfam:PKD_channel	513	667	6.7e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
low complexity region	804	818	N/A	INTRINSIC
Pfam:Ion_trans	834	1064	3.9e-53	PFAM
Pfam:Ion_trans	1152	1361	6.7e-66	PFAM
Pfam:PKD_channel	1201	1368	8.4e-10	PFAM
Blast:EFh	1382	1410	5e-8	BLAST
Ca_chan_IQ	1496	1529	3.71e-14	SMART
low complexity region	1638	1650	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000160641
AA Change: Y299C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: Y299C

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	88	333	9.3e-57	PFAM
PDB:4DEY\|B	334	417	1e-20	PDB
Pfam:Ion_trans	466	660	3.8e-46	PFAM
Pfam:PKD_channel	513	667	6.7e-7	PFAM
low complexity region	675	685	N/A	INTRINSIC
low complexity region	740	756	N/A	INTRINSIC
low complexity region	804	818	N/A	INTRINSIC
Pfam:Ion_trans	834	1064	4e-53	PFAM
Pfam:PKD_channel	1126	1387	6.1e-12	PFAM
Pfam:Ion_trans	1152	1380	9e-65	PFAM
Blast:EFh	1401	1429	5e-8	BLAST
Ca_chan_IQ	1515	1548	3.71e-14	SMART
low complexity region	1657	1669	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161865
AA Change: Y52C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407
AA Change: Y52C

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	3	98	1.1e-21	PFAM
Pfam:Ion_trans	184	425	3.3e-56	PFAM
Pfam:PKD_channel	267	420	1.8e-7	PFAM
low complexity region	428	438	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
Pfam:Ion_trans	551	829	1.9e-65	PFAM
Pfam:Ion_trans	870	1126	5.4e-72	PFAM
Pfam:PKD_channel	954	1121	7.2e-10	PFAM
Pfam:GPHH	1128	1197	1.8e-38	PFAM
Ca_chan_IQ	1249	1282	3.71e-14	SMART
low complexity region	1391	1403	N/A	INTRINSIC

Meta Mutation Damage Score

0.9604

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,274,828	Q1346R	probably damaging	Het
4833439L19Rik	A	G	13: 54,552,691	V278A	probably benign	Het
4932415D10Rik	G	A	10: 82,291,297	R1960W	possibly damaging	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abce1	C	A	8: 79,685,256	G592*	probably null	Het
Acad10	A	C	5: 121,649,475	V137G	possibly damaging	Het
Adcy3	A	G	12: 4,203,563	I672V	not run	Het
Adgrb1	A	T	15: 74,580,663	Q1166L	possibly damaging	Het
Ankrd44	A	T	1: 54,729,796	N465K	probably damaging	Het
Avpr1b	A	G	1: 131,609,731	T418A	probably benign	Het
Azin1	G	A	15: 38,501,408	T33I	probably damaging	Het
Bicra	T	C	7: 15,972,500	T1339A	probably damaging	Het
Clip1	A	C	5: 123,613,794	C641W		Het
Clip3	T	C	7: 30,305,812	S524P	probably damaging	Het
Cnpy4	A	T	5: 138,192,882	H240L	probably benign	Het
Cyp2b19	T	C	7: 26,766,914	Y381H	probably damaging	Het
Cyp3a13	T	A	5: 137,905,556	N280I	probably benign	Het
Diaph3	A	G	14: 86,866,584	F788S	probably damaging	Het
Drc7	A	G	8: 95,071,579	N484S	probably damaging	Het
Erap1	G	A	13: 74,673,784		probably null	Het
Fat4	A	T	3: 38,889,693	I912F	probably damaging	Het
Hsd3b3	T	A	3: 98,742,357	K217*	probably null	Het
Igkv12-89	A	G	6: 68,835,077	V36A	probably damaging	Het
Invs	T	A	4: 48,392,526		probably null	Het
Ipo8	T	A	6: 148,824,481	Y30F	possibly damaging	Het
Kctd14	T	C	7: 97,451,486	M1T	probably null	Het
Klrb1c	A	T	6: 128,784,257	C136S	probably benign	Het
Morn2	A	G	17: 80,297,259	E48G	probably damaging	Het
Myh1	A	T	11: 67,201,844		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nfxl1	A	G	5: 72,529,050	S603P	probably benign	Het
Nlrc3	G	A	16: 3,947,877	A351V	probably benign	Het
Nlrp4f	G	A	13: 65,195,538	R76*	probably null	Het
Olfr190	A	T	16: 59,074,192	M296K	probably benign	Het
Olfr228	A	T	2: 86,483,139	I201N	probably damaging	Het
Olfr397	T	C	11: 73,964,808	S67P	probably damaging	Het
Olfr664	G	T	7: 104,733,593	T257K	probably damaging	Het
Olfr872	A	C	9: 20,260,259	I140L	probably damaging	Het
Papolg	A	G	11: 23,867,394	V601A	not run	Het
Pde4dip	T	C	3: 97,758,882	T349A	probably benign	Het
Pdlim5	T	C	3: 142,311,980		probably null	Het
Pkhd1l1	A	G	15: 44,503,280	N718S	probably benign	Het
Plcxd3	A	G	15: 4,516,919	H135R	probably damaging	Het
Plxna2	A	T	1: 194,644,883	Y375F	probably damaging	Het
Prkca	C	T	11: 108,340,645		probably null	Het
Prkdc	A	G	16: 15,717,764	S1663G	probably benign	Het
Ptbp3	T	C	4: 59,514,384	T80A	probably benign	Het
Ptpn4	C	T	1: 119,682,531	V696I	possibly damaging	Het
Pygl	A	T	12: 70,216,568	W175R	possibly damaging	Het
Rftn1	A	G	17: 50,047,441	Y298H	probably damaging	Het
Rit2	A	G	18: 31,316,839		probably null	Het
Runx1t1	G	A	4: 13,846,935	G240R	probably damaging	Het
Scn10a	A	G	9: 119,664,779		probably null	Het
Serpina16	A	C	12: 103,672,432		probably null	Het
Slc17a3	A	T	13: 23,855,848	M290L		Het
Slc6a4	A	T	11: 77,010,696	M86L	probably benign	Het
Spag7	A	T	11: 70,665,313	V46E	probably benign	Het
Sptlc1	T	C	13: 53,344,878	I271V	probably benign	Het
Stk17b	A	C	1: 53,757,515	H364Q	probably benign	Het
Strc	T	C	2: 121,379,452	H130R	probably damaging	Het
Stxbp1	T	A	2: 32,815,014	D148V	probably damaging	Het
Tirap	G	A	9: 35,188,929	P153L	probably damaging	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tmem51	T	A	4: 142,031,783	D218V	probably damaging	Het
Trim40	A	T	17: 36,882,662	D218E	probably benign	Het
Ttc21b	T	C	2: 66,208,718	D934G	probably damaging	Het
Vmn2r26	T	C	6: 124,025,955	L108P	probably damaging	Het
Washc2	C	A	6: 116,227,418	P429Q	probably damaging	Het
Wipi1	A	G	11: 109,611,311	M1T	probably null	Het
Zfp438	A	G	18: 5,214,712	V82A	probably damaging	Het
Zfp853	G	C	5: 143,287,738	A724G	unknown	Het

Other mutations in Cacna1s

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Cacna1s	APN	1	136084273	nonsense	probably null
IGL00517:Cacna1s	APN	1	136087339	missense	probably damaging	1.00
IGL01316:Cacna1s	APN	1	136118964	missense	probably benign	0.01
IGL01348:Cacna1s	APN	1	136075152	missense	possibly damaging	0.95
IGL01739:Cacna1s	APN	1	136097132	critical splice donor site	probably null
IGL01773:Cacna1s	APN	1	136118753	missense	probably benign	0.32
IGL02056:Cacna1s	APN	1	136119000	missense	probably benign
IGL02262:Cacna1s	APN	1	136108129	missense	probably damaging	0.98
IGL02324:Cacna1s	APN	1	136075176	splice site	probably benign
IGL02352:Cacna1s	APN	1	136093252	splice site	probably benign
IGL02359:Cacna1s	APN	1	136093252	splice site	probably benign
IGL02370:Cacna1s	APN	1	136085347	missense	probably damaging	1.00
IGL02377:Cacna1s	APN	1	136068994	missense	probably damaging	1.00
IGL02474:Cacna1s	APN	1	136118380	missense	probably benign
IGL02606:Cacna1s	APN	1	136079519	missense	probably damaging	0.99
IGL02833:Cacna1s	APN	1	136071005	missense	probably benign	0.03
IGL02974:Cacna1s	APN	1	136092617	missense	possibly damaging	0.78
IGL03064:Cacna1s	APN	1	136111993	missense	probably damaging	1.00
IGL03093:Cacna1s	APN	1	136116064	missense	probably benign	0.00
IGL03286:Cacna1s	APN	1	136077659	missense	probably benign
brookstone	UTSW	1	136092694	missense	probably benign	0.01
flyfish	UTSW	1	136116061	missense	probably benign	0.21
forelle	UTSW	1	136095858	missense	probably damaging	0.99
river	UTSW	1	136105844	missense	possibly damaging	0.88
stream	UTSW	1	136105814	missense	probably damaging	1.00
BB009:Cacna1s	UTSW	1	136084359	missense	probably damaging	0.99
BB019:Cacna1s	UTSW	1	136084359	missense	probably damaging	0.99
G1Funyon:Cacna1s	UTSW	1	136073441	unclassified	probably benign
N/A:Cacna1s	UTSW	1	136073509	missense	probably benign	0.00
R0030:Cacna1s	UTSW	1	136094989	critical splice donor site	probably null
R0030:Cacna1s	UTSW	1	136094989	critical splice donor site	probably null
R0097:Cacna1s	UTSW	1	136100622	missense	possibly damaging	0.79
R0097:Cacna1s	UTSW	1	136100622	missense	possibly damaging	0.79
R0240:Cacna1s	UTSW	1	136073496	unclassified	probably benign
R0255:Cacna1s	UTSW	1	136118806	missense	possibly damaging	0.93
R0302:Cacna1s	UTSW	1	136100604	missense	probably benign	0.01
R0319:Cacna1s	UTSW	1	136070717	missense	probably damaging	0.99
R0411:Cacna1s	UTSW	1	136113303	missense	probably damaging	1.00
R0413:Cacna1s	UTSW	1	136098209	missense	probably benign	0.00
R0482:Cacna1s	UTSW	1	136113394	missense	probably benign
R0491:Cacna1s	UTSW	1	136089008	splice site	probably benign
R0518:Cacna1s	UTSW	1	136076859	missense	probably benign
R0717:Cacna1s	UTSW	1	136098291	missense	probably damaging	1.00
R0725:Cacna1s	UTSW	1	136098526	splice site	probably benign
R0815:Cacna1s	UTSW	1	136112957	missense	possibly damaging	0.95
R1384:Cacna1s	UTSW	1	136094971	missense	probably benign	0.02
R1518:Cacna1s	UTSW	1	136098551	missense	probably damaging	1.00
R1548:Cacna1s	UTSW	1	136110937	missense	probably damaging	1.00
R1725:Cacna1s	UTSW	1	136098623	missense	probably damaging	1.00
R1728:Cacna1s	UTSW	1	136118716	missense	probably benign
R1729:Cacna1s	UTSW	1	136118716	missense	probably benign
R1730:Cacna1s	UTSW	1	136118716	missense	probably benign
R1739:Cacna1s	UTSW	1	136118716	missense	probably benign
R1762:Cacna1s	UTSW	1	136118716	missense	probably benign
R1783:Cacna1s	UTSW	1	136118716	missense	probably benign
R1784:Cacna1s	UTSW	1	136118716	missense	probably benign
R1785:Cacna1s	UTSW	1	136118716	missense	probably benign
R1800:Cacna1s	UTSW	1	136076854	missense	probably benign
R1924:Cacna1s	UTSW	1	136089017	splice site	probably null
R1969:Cacna1s	UTSW	1	136119095	missense	probably benign	0.42
R2072:Cacna1s	UTSW	1	136079504	missense	probably benign
R2380:Cacna1s	UTSW	1	136095848	missense	probably damaging	1.00
R3110:Cacna1s	UTSW	1	136075093	nonsense	probably null
R3112:Cacna1s	UTSW	1	136075093	nonsense	probably null
R3151:Cacna1s	UTSW	1	136105794	missense	probably damaging	1.00
R3696:Cacna1s	UTSW	1	136105814	missense	probably damaging	1.00
R3722:Cacna1s	UTSW	1	136069042	missense	possibly damaging	0.77
R3804:Cacna1s	UTSW	1	136107018	missense	possibly damaging	0.85
R3813:Cacna1s	UTSW	1	136085347	missense	probably damaging	1.00
R3905:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R3907:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R3909:Cacna1s	UTSW	1	136084269	missense	probably damaging	0.99
R4170:Cacna1s	UTSW	1	136108195	missense	probably damaging	1.00
R4329:Cacna1s	UTSW	1	136119033	missense	probably benign	0.00
R4485:Cacna1s	UTSW	1	136076852	missense	probably damaging	1.00
R4581:Cacna1s	UTSW	1	136070970	splice site	probably null
R4719:Cacna1s	UTSW	1	136118652	splice site	probably benign
R4816:Cacna1s	UTSW	1	136115269	missense	possibly damaging	0.89
R4909:Cacna1s	UTSW	1	136079604	missense	probably damaging	0.99
R4917:Cacna1s	UTSW	1	136101564	critical splice donor site	probably null
R5296:Cacna1s	UTSW	1	136095785	missense	probably benign	0.11
R5411:Cacna1s	UTSW	1	136105811	missense	probably benign	0.09
R5503:Cacna1s	UTSW	1	136086742	missense	probably damaging	1.00
R5533:Cacna1s	UTSW	1	136098375	critical splice donor site	probably null
R5714:Cacna1s	UTSW	1	136112066	missense	probably benign	0.44
R5775:Cacna1s	UTSW	1	136108122	missense	probably damaging	1.00
R5814:Cacna1s	UTSW	1	136107142	missense	probably benign	0.31
R5820:Cacna1s	UTSW	1	136079604	missense	probably damaging	1.00
R5822:Cacna1s	UTSW	1	136112078	missense	probably damaging	1.00
R5877:Cacna1s	UTSW	1	136100667	missense	probably damaging	0.99
R5923:Cacna1s	UTSW	1	136076822	missense	possibly damaging	0.79
R6021:Cacna1s	UTSW	1	136106487	missense	probably benign	0.15
R6037:Cacna1s	UTSW	1	136070967	missense	possibly damaging	0.90
R6037:Cacna1s	UTSW	1	136070967	missense	possibly damaging	0.90
R6056:Cacna1s	UTSW	1	136105836	missense	probably damaging	1.00
R6143:Cacna1s	UTSW	1	136076758	missense	probably damaging	0.99
R6222:Cacna1s	UTSW	1	136104622	missense	probably benign	0.00
R6237:Cacna1s	UTSW	1	136105844	missense	possibly damaging	0.88
R6274:Cacna1s	UTSW	1	136089045	missense	probably benign	0.02
R6609:Cacna1s	UTSW	1	136113391	missense	probably benign	0.30
R6626:Cacna1s	UTSW	1	136094965	missense	probably damaging	1.00
R6838:Cacna1s	UTSW	1	136084437	missense	possibly damaging	0.91
R6848:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6849:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6850:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6851:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6868:Cacna1s	UTSW	1	136092694	missense	probably benign	0.01
R6879:Cacna1s	UTSW	1	136115959	missense	probably benign	0.12
R6893:Cacna1s	UTSW	1	136077693	missense	probably benign	0.05
R7017:Cacna1s	UTSW	1	136095858	missense	probably damaging	0.99
R7228:Cacna1s	UTSW	1	136071059	missense	possibly damaging	0.90
R7357:Cacna1s	UTSW	1	136071021	missense	probably damaging	0.99
R7385:Cacna1s	UTSW	1	136092633	missense	probably damaging	0.99
R7421:Cacna1s	UTSW	1	136086802	missense	probably damaging	1.00
R7505:Cacna1s	UTSW	1	136085449	nonsense	probably null
R7519:Cacna1s	UTSW	1	136070756	missense	probably damaging	0.99
R7675:Cacna1s	UTSW	1	136110874	missense	probably damaging	1.00
R7746:Cacna1s	UTSW	1	136069018	missense	probably damaging	0.99
R7779:Cacna1s	UTSW	1	136119029	missense	probably damaging	1.00
R7850:Cacna1s	UTSW	1	136071048	missense	probably damaging	1.00
R7932:Cacna1s	UTSW	1	136084359	missense	probably damaging	0.99
R7935:Cacna1s	UTSW	1	136092595	missense	possibly damaging	0.62
R7950:Cacna1s	UTSW	1	136100625	missense	probably benign	0.01
R7969:Cacna1s	UTSW	1	136076732	missense	probably damaging	1.00
R8083:Cacna1s	UTSW	1	136095791	missense	possibly damaging	0.91
R8101:Cacna1s	UTSW	1	136118665	missense	probably benign	0.02
R8123:Cacna1s	UTSW	1	136108179	missense	probably damaging	1.00
R8191:Cacna1s	UTSW	1	136108155	missense	probably damaging	1.00
R8194:Cacna1s	UTSW	1	136077692	missense	probably benign	0.33
R8251:Cacna1s	UTSW	1	136086723	missense	probably damaging	1.00
R8265:Cacna1s	UTSW	1	136092626	nonsense	probably null
R8301:Cacna1s	UTSW	1	136073441	unclassified	probably benign
R8310:Cacna1s	UTSW	1	136087337	missense	probably damaging	1.00
R8359:Cacna1s	UTSW	1	136116061	missense	probably benign	0.21
R8461:Cacna1s	UTSW	1	136073702	missense	possibly damaging	0.53
R8553:Cacna1s	UTSW	1	136091802	missense	possibly damaging	0.93
R8743:Cacna1s	UTSW	1	136105548	missense	probably damaging	1.00
R8766:Cacna1s	UTSW	1	136075143	missense	probably damaging	1.00
R8884:Cacna1s	UTSW	1	136115243	missense	probably benign	0.05
R8897:Cacna1s	UTSW	1	136117654	missense	probably benign	0.01
R8939:Cacna1s	UTSW	1	136086806	critical splice donor site	probably null
R8953:Cacna1s	UTSW	1	136097432	missense	possibly damaging	0.94
R9039:Cacna1s	UTSW	1	136088319	missense	probably benign
R9058:Cacna1s	UTSW	1	136070698	nonsense	probably null
R9137:Cacna1s	UTSW	1	136069006	missense	possibly damaging	0.89
R9332:Cacna1s	UTSW	1	136092714	nonsense	probably null
R9416:Cacna1s	UTSW	1	136094951	missense	possibly damaging	0.88
R9427:Cacna1s	UTSW	1	136084352	missense	probably benign	0.30
R9446:Cacna1s	UTSW	1	136117624	missense	probably benign	0.00
R9564:Cacna1s	UTSW	1	136118778	missense	probably benign
R9620:Cacna1s	UTSW	1	136108171	missense	probably damaging	1.00
X0025:Cacna1s	UTSW	1	136115970	missense	probably benign	0.00
Z1176:Cacna1s	UTSW	1	136107084	nonsense	probably null
Z1177:Cacna1s	UTSW	1	136117686	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCACCCTGTGCTAGAACTGG -3'
(R):5'- AACCCATGGAGCTCCTAGTAC -3'

Sequencing Primer
(F):5'- CCTGTGCTAGAACTGGCTCTG -3'
(R):5'- ATGGAGCTCCTAGTACCCATC -3'

Posted On

2019-06-26