Mutagenetix > Incidental Mutation

Incidental Mutation 'R7283:Pde4dip'

565779

Institutional Source

Beutler Lab

Gene Symbol

Pde4dip

Ensembl Gene

ENSMUSG00000038170

Gene Name

phosphodiesterase 4D interacting protein (myomegalin)

Synonyms

D130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik

MMRRC Submission

045361-MU

Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

97689824-97888707 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 97758882 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 349 (T349A)

Ref Sequence

ENSEMBL: ENSMUSP00000088254 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045243] [ENSMUST00000090750] [ENSMUST00000107038] [ENSMUST00000168438] [ENSMUST00000175751]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000045243
AA Change: T392A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000040905
Gene: ENSMUSG00000038170
AA Change: T392A

Domain	Start	End	E-Value	Type
low complexity region	72	90	N/A	INTRINSIC
low complexity region	159	170	N/A	INTRINSIC
coiled coil region	399	451	N/A	INTRINSIC
SCOP:d1gw5a_	613	839	3e-3	SMART
coiled coil region	909	985	N/A	INTRINSIC
low complexity region	1081	1099	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090750
AA Change: T349A

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: T349A

Domain	Start	End	E-Value	Type
low complexity region	10	40	N/A	INTRINSIC
low complexity region	45	57	N/A	INTRINSIC
Pfam:Cnn_1N	124	196	3.2e-26	PFAM
low complexity region	204	219	N/A	INTRINSIC
coiled coil region	282	325	N/A	INTRINSIC
internal_repeat_1	397	438	4.03e-5	PROSPERO
low complexity region	567	578	N/A	INTRINSIC
internal_repeat_2	617	667	6.59e-5	PROSPERO
internal_repeat_1	620	661	4.03e-5	PROSPERO
coiled coil region	866	942	N/A	INTRINSIC
low complexity region	1038	1056	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
coiled coil region	1118	1163	N/A	INTRINSIC
coiled coil region	1336	1363	N/A	INTRINSIC
low complexity region	1403	1420	N/A	INTRINSIC
coiled coil region	1470	1508	N/A	INTRINSIC
internal_repeat_2	1597	1644	6.59e-5	PROSPERO
DUF1220	1680	1747	1.17e-17	SMART
low complexity region	1758	1780	N/A	INTRINSIC
low complexity region	1836	1851	N/A	INTRINSIC
low complexity region	1860	1874	N/A	INTRINSIC
low complexity region	1940	1951	N/A	INTRINSIC
coiled coil region	1962	2138	N/A	INTRINSIC
coiled coil region	2162	2197	N/A	INTRINSIC
coiled coil region	2387	2431	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107038
AA Change: T295A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000102653
Gene: ENSMUSG00000038170
AA Change: T295A

Domain	Start	End	E-Value	Type
Pfam:Microtub_assoc	70	144	7.8e-32	PFAM
low complexity region	150	165	N/A	INTRINSIC
coiled coil region	228	271	N/A	INTRINSIC
internal_repeat_1	343	384	5.54e-5	PROSPERO
low complexity region	513	524	N/A	INTRINSIC
internal_repeat_1	566	607	5.54e-5	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000168438
AA Change: T349A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: T349A

Domain	Start	End	E-Value	Type
low complexity region	10	40	N/A	INTRINSIC
low complexity region	45	57	N/A	INTRINSIC
Pfam:Microtub_assoc	124	198	1.4e-31	PFAM
low complexity region	204	219	N/A	INTRINSIC
coiled coil region	282	325	N/A	INTRINSIC
internal_repeat_1	397	438	3.56e-5	PROSPERO
low complexity region	567	578	N/A	INTRINSIC
internal_repeat_2	617	667	5.83e-5	PROSPERO
internal_repeat_1	620	661	3.56e-5	PROSPERO
coiled coil region	866	942	N/A	INTRINSIC
low complexity region	1038	1056	N/A	INTRINSIC
low complexity region	1067	1082	N/A	INTRINSIC
coiled coil region	1118	1163	N/A	INTRINSIC
coiled coil region	1336	1363	N/A	INTRINSIC
low complexity region	1403	1420	N/A	INTRINSIC
coiled coil region	1470	1508	N/A	INTRINSIC
internal_repeat_2	1597	1644	5.83e-5	PROSPERO
DUF1220	1680	1747	1.17e-17	SMART
low complexity region	1758	1769	N/A	INTRINSIC
low complexity region	1785	1800	N/A	INTRINSIC
low complexity region	1809	1823	N/A	INTRINSIC
low complexity region	1889	1900	N/A	INTRINSIC
coiled coil region	1911	2087	N/A	INTRINSIC
coiled coil region	2111	2146	N/A	INTRINSIC
coiled coil region	2336	2380	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175751
AA Change: T392A

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000134832
Gene: ENSMUSG00000038170
AA Change: T392A

Domain	Start	End	E-Value	Type
Pfam:zf-AD	4	78	4.3e-8	PFAM
low complexity region	159	170	N/A	INTRINSIC
coiled coil region	399	451	N/A	INTRINSIC
coiled coil region	513	538	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,274,828	Q1346R	probably damaging	Het
4833439L19Rik	A	G	13: 54,552,691	V278A	probably benign	Het
4932415D10Rik	G	A	10: 82,291,297	R1960W	possibly damaging	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abce1	C	A	8: 79,685,256	G592*	probably null	Het
Acad10	A	C	5: 121,649,475	V137G	possibly damaging	Het
Adcy3	A	G	12: 4,203,563	I672V	not run	Het
Adgrb1	A	T	15: 74,580,663	Q1166L	possibly damaging	Het
Ankrd44	A	T	1: 54,729,796	N465K	probably damaging	Het
Avpr1b	A	G	1: 131,609,731	T418A	probably benign	Het
Azin1	G	A	15: 38,501,408	T33I	probably damaging	Het
Bicra	T	C	7: 15,972,500	T1339A	probably damaging	Het
Cacna1s	A	G	1: 136,073,708	Y299C	probably damaging	Het
Clip1	A	C	5: 123,613,794	C641W		Het
Clip3	T	C	7: 30,305,812	S524P	probably damaging	Het
Cnpy4	A	T	5: 138,192,882	H240L	probably benign	Het
Cyp2b19	T	C	7: 26,766,914	Y381H	probably damaging	Het
Cyp3a13	T	A	5: 137,905,556	N280I	probably benign	Het
Diaph3	A	G	14: 86,866,584	F788S	probably damaging	Het
Drc7	A	G	8: 95,071,579	N484S	probably damaging	Het
Erap1	G	A	13: 74,673,784		probably null	Het
Fat4	A	T	3: 38,889,693	I912F	probably damaging	Het
Hsd3b3	T	A	3: 98,742,357	K217*	probably null	Het
Igkv12-89	A	G	6: 68,835,077	V36A	probably damaging	Het
Invs	T	A	4: 48,392,526		probably null	Het
Ipo8	T	A	6: 148,824,481	Y30F	possibly damaging	Het
Kctd14	T	C	7: 97,451,486	M1T	probably null	Het
Klrb1c	A	T	6: 128,784,257	C136S	probably benign	Het
Morn2	A	G	17: 80,297,259	E48G	probably damaging	Het
Myh1	A	T	11: 67,201,844		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nfxl1	A	G	5: 72,529,050	S603P	probably benign	Het
Nlrc3	G	A	16: 3,947,877	A351V	probably benign	Het
Nlrp4f	G	A	13: 65,195,538	R76*	probably null	Het
Olfr190	A	T	16: 59,074,192	M296K	probably benign	Het
Olfr228	A	T	2: 86,483,139	I201N	probably damaging	Het
Olfr397	T	C	11: 73,964,808	S67P	probably damaging	Het
Olfr664	G	T	7: 104,733,593	T257K	probably damaging	Het
Olfr872	A	C	9: 20,260,259	I140L	probably damaging	Het
Papolg	A	G	11: 23,867,394	V601A	not run	Het
Pdlim5	T	C	3: 142,311,980		probably null	Het
Pkhd1l1	A	G	15: 44,503,280	N718S	probably benign	Het
Plcxd3	A	G	15: 4,516,919	H135R	probably damaging	Het
Plxna2	A	T	1: 194,644,883	Y375F	probably damaging	Het
Prkca	C	T	11: 108,340,645		probably null	Het
Prkdc	A	G	16: 15,717,764	S1663G	probably benign	Het
Ptbp3	T	C	4: 59,514,384	T80A	probably benign	Het
Ptpn4	C	T	1: 119,682,531	V696I	possibly damaging	Het
Pygl	A	T	12: 70,216,568	W175R	possibly damaging	Het
Rftn1	A	G	17: 50,047,441	Y298H	probably damaging	Het
Rit2	A	G	18: 31,316,839		probably null	Het
Runx1t1	G	A	4: 13,846,935	G240R	probably damaging	Het
Scn10a	A	G	9: 119,664,779		probably null	Het
Serpina16	A	C	12: 103,672,432		probably null	Het
Slc17a3	A	T	13: 23,855,848	M290L		Het
Slc6a4	A	T	11: 77,010,696	M86L	probably benign	Het
Spag7	A	T	11: 70,665,313	V46E	probably benign	Het
Sptlc1	T	C	13: 53,344,878	I271V	probably benign	Het
Stk17b	A	C	1: 53,757,515	H364Q	probably benign	Het
Strc	T	C	2: 121,379,452	H130R	probably damaging	Het
Stxbp1	T	A	2: 32,815,014	D148V	probably damaging	Het
Tirap	G	A	9: 35,188,929	P153L	probably damaging	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tmem51	T	A	4: 142,031,783	D218V	probably damaging	Het
Trim40	A	T	17: 36,882,662	D218E	probably benign	Het
Ttc21b	T	C	2: 66,208,718	D934G	probably damaging	Het
Vmn2r26	T	C	6: 124,025,955	L108P	probably damaging	Het
Washc2	C	A	6: 116,227,418	P429Q	probably damaging	Het
Wipi1	A	G	11: 109,611,311	M1T	probably null	Het
Zfp438	A	G	18: 5,214,712	V82A	probably damaging	Het
Zfp853	G	C	5: 143,287,738	A724G	unknown	Het

Other mutations in Pde4dip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Pde4dip	APN	3	97767277	missense	probably benign	0.00
IGL00543:Pde4dip	APN	3	97757624	missense	possibly damaging	0.91
IGL00979:Pde4dip	APN	3	97747758	splice site	probably benign
IGL01483:Pde4dip	APN	3	97754149	missense	probably damaging	1.00
IGL02122:Pde4dip	APN	3	97767421	missense	probably damaging	1.00
IGL02398:Pde4dip	APN	3	97766781	missense	probably benign
IGL02814:Pde4dip	APN	3	97767100	missense	probably damaging	1.00
IGL02826:Pde4dip	APN	3	97767087	missense	probably damaging	1.00
D3080:Pde4dip	UTSW	3	97766830	missense	probably damaging	1.00
R0077:Pde4dip	UTSW	3	97753126	nonsense	probably null
R0096:Pde4dip	UTSW	3	97767467	missense	probably damaging	0.99
R0277:Pde4dip	UTSW	3	97843712	missense	probably benign	0.01
R0304:Pde4dip	UTSW	3	97843712	missense	probably benign	0.01
R0616:Pde4dip	UTSW	3	97747533	missense	probably benign	0.09
R0676:Pde4dip	UTSW	3	97717097	splice site	probably benign
R1166:Pde4dip	UTSW	3	97713196	missense	possibly damaging	0.94
R1376:Pde4dip	UTSW	3	97743217	missense	probably damaging	0.99
R1376:Pde4dip	UTSW	3	97743217	missense	probably damaging	0.99
R1452:Pde4dip	UTSW	3	97724102	missense	probably damaging	1.00
R1550:Pde4dip	UTSW	3	97719704	missense	probably damaging	1.00
R1700:Pde4dip	UTSW	3	97703323	missense	probably benign	0.00
R1704:Pde4dip	UTSW	3	97754260	missense	probably benign	0.28
R1769:Pde4dip	UTSW	3	97695930	missense	probably benign	0.00
R1934:Pde4dip	UTSW	3	97692691	missense	possibly damaging	0.74
R1980:Pde4dip	UTSW	3	97756996	missense	possibly damaging	0.93
R2088:Pde4dip	UTSW	3	97754433	missense	probably null	1.00
R2143:Pde4dip	UTSW	3	97888519	missense	possibly damaging	0.86
R2149:Pde4dip	UTSW	3	97792836	missense	possibly damaging	0.64
R2156:Pde4dip	UTSW	3	97724218	missense	probably damaging	0.98
R2158:Pde4dip	UTSW	3	97757621	missense	probably benign	0.15
R2240:Pde4dip	UTSW	3	97724164	missense	probably benign	0.00
R2249:Pde4dip	UTSW	3	97793525	missense	probably damaging	1.00
R2256:Pde4dip	UTSW	3	97718184	missense	probably damaging	1.00
R2680:Pde4dip	UTSW	3	97701617	missense	possibly damaging	0.92
R2921:Pde4dip	UTSW	3	97719569	missense	probably benign
R3407:Pde4dip	UTSW	3	97754468	missense	probably damaging	1.00
R3736:Pde4dip	UTSW	3	97724111	missense	probably damaging	1.00
R3787:Pde4dip	UTSW	3	97715552	missense	possibly damaging	0.80
R3883:Pde4dip	UTSW	3	97713188	missense	probably damaging	1.00
R4437:Pde4dip	UTSW	3	97766569	missense	possibly damaging	0.52
R4528:Pde4dip	UTSW	3	97717022	missense	probably damaging	1.00
R4576:Pde4dip	UTSW	3	97754249	missense	probably damaging	1.00
R4600:Pde4dip	UTSW	3	97695944	missense	probably damaging	0.98
R4653:Pde4dip	UTSW	3	97767338	missense	probably damaging	0.99
R4678:Pde4dip	UTSW	3	97695005	missense	probably damaging	1.00
R4679:Pde4dip	UTSW	3	97695005	missense	probably damaging	1.00
R4688:Pde4dip	UTSW	3	97843677	nonsense	probably null
R4770:Pde4dip	UTSW	3	97767084	missense	probably damaging	1.00
R4841:Pde4dip	UTSW	3	97793528	missense	probably damaging	1.00
R4842:Pde4dip	UTSW	3	97793528	missense	probably damaging	1.00
R4899:Pde4dip	UTSW	3	97709558	missense	probably damaging	1.00
R4914:Pde4dip	UTSW	3	97715328	missense	probably benign	0.10
R4943:Pde4dip	UTSW	3	97755511	missense	probably damaging	0.99
R5131:Pde4dip	UTSW	3	97709514	missense	probably damaging	0.98
R5408:Pde4dip	UTSW	3	97796736	missense	probably benign	0.35
R5583:Pde4dip	UTSW	3	97747576	missense	possibly damaging	0.67
R5677:Pde4dip	UTSW	3	97841648	nonsense	probably null
R5689:Pde4dip	UTSW	3	97692367	nonsense	probably null
R5696:Pde4dip	UTSW	3	97709490	missense	probably damaging	1.00
R5860:Pde4dip	UTSW	3	97724188	missense	possibly damaging	0.68
R6279:Pde4dip	UTSW	3	97699180	missense	probably damaging	1.00
R6341:Pde4dip	UTSW	3	97694911	missense	probably benign
R6440:Pde4dip	UTSW	3	97767586	missense	probably damaging	1.00
R6464:Pde4dip	UTSW	3	97710344	missense	probably damaging	1.00
R6489:Pde4dip	UTSW	3	97755591	nonsense	probably null
R6706:Pde4dip	UTSW	3	97741393	missense	probably damaging	1.00
R6722:Pde4dip	UTSW	3	97718239	nonsense	probably null
R6798:Pde4dip	UTSW	3	97888534	missense	probably benign
R6804:Pde4dip	UTSW	3	97793248	nonsense	probably null
R6862:Pde4dip	UTSW	3	97767024	missense	possibly damaging	0.52
R6957:Pde4dip	UTSW	3	97824333	splice site	probably null
R6983:Pde4dip	UTSW	3	97718236	missense	probably damaging	1.00
R7014:Pde4dip	UTSW	3	97715422	missense	possibly damaging	0.54
R7025:Pde4dip	UTSW	3	97724183	nonsense	probably null
R7136:Pde4dip	UTSW	3	97694063	missense	probably benign	0.03
R7178:Pde4dip	UTSW	3	97715630	missense	probably benign	0.26
R7269:Pde4dip	UTSW	3	97766959	missense	probably damaging	1.00
R7354:Pde4dip	UTSW	3	97719330	missense	probably damaging	0.99
R7357:Pde4dip	UTSW	3	97715541	missense	probably benign	0.01
R7360:Pde4dip	UTSW	3	97718316	missense	probably benign	0.01
R7371:Pde4dip	UTSW	3	97757271	missense	probably benign	0.08
R7432:Pde4dip	UTSW	3	97695092	missense	probably benign
R7536:Pde4dip	UTSW	3	97757244	missense	probably damaging	1.00
R7542:Pde4dip	UTSW	3	97766655	missense	possibly damaging	0.59
R7609:Pde4dip	UTSW	3	97715565	missense	possibly damaging	0.85
R7650:Pde4dip	UTSW	3	97699107	critical splice donor site	probably null
R7800:Pde4dip	UTSW	3	97715283	missense	probably damaging	1.00
R7846:Pde4dip	UTSW	3	97715174	missense	probably damaging	1.00
R7918:Pde4dip	UTSW	3	97715223	nonsense	probably null
R8120:Pde4dip	UTSW	3	97706938	missense	probably null	0.94
R8139:Pde4dip	UTSW	3	97696993	missense	probably benign	0.02
R8144:Pde4dip	UTSW	3	97715426	missense	probably damaging	1.00
R8177:Pde4dip	UTSW	3	97767532	missense	probably damaging	0.98
R8294:Pde4dip	UTSW	3	97767378	missense	probably damaging	1.00
R8406:Pde4dip	UTSW	3	97699112	missense	probably benign	0.04
R8911:Pde4dip	UTSW	3	97743601	missense	probably benign	0.22
R8912:Pde4dip	UTSW	3	97710317	missense	probably damaging	1.00
R8960:Pde4dip	UTSW	3	97793148	missense	probably damaging	1.00
R8993:Pde4dip	UTSW	3	97766494	missense	probably damaging	1.00
R9031:Pde4dip	UTSW	3	97692359	missense	probably damaging	1.00
R9032:Pde4dip	UTSW	3	97694069	missense	probably benign	0.00
R9085:Pde4dip	UTSW	3	97694069	missense	probably benign	0.00
R9103:Pde4dip	UTSW	3	97841728	missense	probably damaging	1.00
R9163:Pde4dip	UTSW	3	97751807	critical splice donor site	probably null
R9182:Pde4dip	UTSW	3	97694998	missense	probably benign	0.13
R9185:Pde4dip	UTSW	3	97758816	missense	probably benign	0.01
R9286:Pde4dip	UTSW	3	97699867	missense	probably damaging	1.00
R9357:Pde4dip	UTSW	3	97718329	missense	probably benign	0.00
R9415:Pde4dip	UTSW	3	97753152	missense	possibly damaging	0.82
R9500:Pde4dip	UTSW	3	97888580	missense	unknown
R9595:Pde4dip	UTSW	3	97694891	critical splice donor site	probably null
R9689:Pde4dip	UTSW	3	97742525	missense	probably damaging	1.00
R9720:Pde4dip	UTSW	3	97695971	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCCATTCTGTAGAGAACAAG -3'
(R):5'- TCTGTGAAGTGGTACTCCTAGC -3'

Sequencing Primer
(F):5'- CCATTCTGTAGAGAACAAGGGATG -3'
(R):5'- ACTGTCTGCTGGAAGTCAC -3'

Posted On

2019-06-26