Incidental Mutation 'R7283:Hsd3b3'
ID 565780
Institutional Source Beutler Lab
Gene Symbol Hsd3b3
Ensembl Gene ENSMUSG00000062410
Gene Name hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 3
Synonyms 9030618K22Rik
MMRRC Submission 045361-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7283 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 98648839-98670443 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 98649673 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 217 (K217*)
Ref Sequence ENSEMBL: ENSMUSP00000088246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090743] [ENSMUST00000094050] [ENSMUST00000107018] [ENSMUST00000107019] [ENSMUST00000146196]
AlphaFold P26150
Predicted Effect probably null
Transcript: ENSMUST00000090743
AA Change: K217*
SMART Domains Protein: ENSMUSP00000088246
Gene: ENSMUSG00000062410
AA Change: K217*

DomainStartEndE-ValueType
Pfam:KR 5 132 8.2e-7 PFAM
Pfam:adh_short 5 133 3.9e-8 PFAM
Pfam:Polysacc_synt_2 6 134 3.5e-13 PFAM
Pfam:NmrA 6 136 2.5e-8 PFAM
Pfam:NAD_binding_10 6 237 5.8e-10 PFAM
Pfam:Epimerase 6 256 1.4e-27 PFAM
Pfam:3Beta_HSD 7 288 1.6e-114 PFAM
Pfam:NAD_binding_4 8 220 1.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094050
AA Change: K162*
SMART Domains Protein: ENSMUSP00000091592
Gene: ENSMUSG00000062410
AA Change: K162*

DomainStartEndE-ValueType
Pfam:3Beta_HSD 7 51 2e-12 PFAM
Pfam:NAD_binding_4 39 162 7.4e-7 PFAM
Pfam:Epimerase 43 201 2.1e-12 PFAM
Pfam:3Beta_HSD 48 233 4.1e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107018
AA Change: K162*
SMART Domains Protein: ENSMUSP00000102632
Gene: ENSMUSG00000062410
AA Change: K162*

DomainStartEndE-ValueType
Pfam:KR 5 132 8.2e-7 PFAM
Pfam:adh_short 5 133 3.9e-8 PFAM
Pfam:Polysacc_synt_2 6 134 3.5e-13 PFAM
Pfam:NmrA 6 136 2.5e-8 PFAM
Pfam:NAD_binding_10 6 237 5.8e-10 PFAM
Pfam:Epimerase 6 256 1.4e-27 PFAM
Pfam:3Beta_HSD 7 288 1.6e-114 PFAM
Pfam:NAD_binding_4 8 220 1.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107019
AA Change: K217*
SMART Domains Protein: ENSMUSP00000102633
Gene: ENSMUSG00000062410
AA Change: K217*

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 6 135 1.9e-13 PFAM
Pfam:NmrA 6 137 5.6e-8 PFAM
Pfam:Epimerase 6 250 2e-26 PFAM
Pfam:GDP_Man_Dehyd 7 213 1.9e-13 PFAM
Pfam:3Beta_HSD 7 288 4.3e-116 PFAM
Pfam:NAD_binding_4 8 207 2.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146196
SMART Domains Protein: ENSMUSP00000121360
Gene: ENSMUSG00000062410

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 174 1.9e-7 PFAM
Pfam:adh_short 5 133 5.6e-9 PFAM
Pfam:KR 5 133 9.5e-8 PFAM
Pfam:Polysacc_synt_2 6 135 2.8e-14 PFAM
Pfam:NmrA 6 137 1.8e-9 PFAM
Pfam:Epimerase 6 187 2.2e-23 PFAM
Pfam:NAD_binding_10 6 187 1.4e-10 PFAM
Pfam:3Beta_HSD 7 187 9.3e-76 PFAM
Pfam:NAD_binding_4 8 176 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,700,504 (GRCm39) V278A probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abce1 C A 8: 80,411,885 (GRCm39) G592* probably null Het
Acad10 A C 5: 121,787,538 (GRCm39) V137G possibly damaging Het
Adcy3 A G 12: 4,253,563 (GRCm39) I672V not run Het
Adgrb1 A T 15: 74,452,512 (GRCm39) Q1166L possibly damaging Het
Ankrd44 A T 1: 54,768,955 (GRCm39) N465K probably damaging Het
Avpr1b A G 1: 131,537,469 (GRCm39) T418A probably benign Het
Azin1 G A 15: 38,501,652 (GRCm39) T33I probably damaging Het
Bicra T C 7: 15,706,425 (GRCm39) T1339A probably damaging Het
Bltp2 A G 11: 78,165,654 (GRCm39) Q1346R probably damaging Het
Cacna1s A G 1: 136,001,446 (GRCm39) Y299C probably damaging Het
Clip1 A C 5: 123,751,857 (GRCm39) C641W Het
Clip3 T C 7: 30,005,237 (GRCm39) S524P probably damaging Het
Cnpy4 A T 5: 138,191,144 (GRCm39) H240L probably benign Het
Cyp2b19 T C 7: 26,466,339 (GRCm39) Y381H probably damaging Het
Cyp3a13 T A 5: 137,903,818 (GRCm39) N280I probably benign Het
Diaph3 A G 14: 87,104,020 (GRCm39) F788S probably damaging Het
Drc7 A G 8: 95,798,207 (GRCm39) N484S probably damaging Het
Erap1 G A 13: 74,821,903 (GRCm39) probably null Het
Fat4 A T 3: 38,943,842 (GRCm39) I912F probably damaging Het
Igkv12-89 A G 6: 68,812,061 (GRCm39) V36A probably damaging Het
Invs T A 4: 48,392,526 (GRCm39) probably null Het
Ipo8 T A 6: 148,725,979 (GRCm39) Y30F possibly damaging Het
Kctd14 T C 7: 97,100,693 (GRCm39) M1T probably null Het
Klrb1c A T 6: 128,761,220 (GRCm39) C136S probably benign Het
Morn2 A G 17: 80,604,688 (GRCm39) E48G probably damaging Het
Myh1 A T 11: 67,092,670 (GRCm39) probably null Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nfxl1 A G 5: 72,686,393 (GRCm39) S603P probably benign Het
Nlrc3 G A 16: 3,765,741 (GRCm39) A351V probably benign Het
Nlrp4f G A 13: 65,343,352 (GRCm39) R76* probably null Het
Or1e1f T C 11: 73,855,634 (GRCm39) S67P probably damaging Het
Or52n1 G T 7: 104,382,800 (GRCm39) T257K probably damaging Het
Or5h22 A T 16: 58,894,555 (GRCm39) M296K probably benign Het
Or7e176 A C 9: 20,171,555 (GRCm39) I140L probably damaging Het
Or8k41 A T 2: 86,313,483 (GRCm39) I201N probably damaging Het
Papolg A G 11: 23,817,394 (GRCm39) V601A not run Het
Pde4dip T C 3: 97,666,198 (GRCm39) T349A probably benign Het
Pdlim5 T C 3: 142,017,741 (GRCm39) probably null Het
Pkhd1l1 A G 15: 44,366,676 (GRCm39) N718S probably benign Het
Plcxd3 A G 15: 4,546,401 (GRCm39) H135R probably damaging Het
Plxna2 A T 1: 194,327,191 (GRCm39) Y375F probably damaging Het
Prkca C T 11: 108,231,471 (GRCm39) probably null Het
Prkdc A G 16: 15,535,628 (GRCm39) S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 (GRCm39) T80A probably benign Het
Ptpn4 C T 1: 119,610,261 (GRCm39) V696I possibly damaging Het
Pygl A T 12: 70,263,342 (GRCm39) W175R possibly damaging Het
Rftn1 A G 17: 50,354,469 (GRCm39) Y298H probably damaging Het
Rit2 A G 18: 31,449,892 (GRCm39) probably null Het
Runx1t1 G A 4: 13,846,935 (GRCm39) G240R probably damaging Het
Scn10a A G 9: 119,493,845 (GRCm39) probably null Het
Serpina16 A C 12: 103,638,691 (GRCm39) probably null Het
Slc17a3 A T 13: 24,039,831 (GRCm39) M290L Het
Slc6a4 A T 11: 76,901,522 (GRCm39) M86L probably benign Het
Spag7 A T 11: 70,556,139 (GRCm39) V46E probably benign Het
Spata31h1 G A 10: 82,127,131 (GRCm39) R1960W possibly damaging Het
Sptlc1 T C 13: 53,498,914 (GRCm39) I271V probably benign Het
Stk17b A C 1: 53,796,674 (GRCm39) H364Q probably benign Het
Strc T C 2: 121,209,933 (GRCm39) H130R probably damaging Het
Stxbp1 T A 2: 32,705,026 (GRCm39) D148V probably damaging Het
Tirap G A 9: 35,100,225 (GRCm39) P153L probably damaging Het
Tmco3 G A 8: 13,369,605 (GRCm39) probably null Het
Tmem51 T A 4: 141,759,094 (GRCm39) D218V probably damaging Het
Trim40 A T 17: 37,193,554 (GRCm39) D218E probably benign Het
Ttc21b T C 2: 66,039,062 (GRCm39) D934G probably damaging Het
Vmn2r26 T C 6: 124,002,914 (GRCm39) L108P probably damaging Het
Washc2 C A 6: 116,204,379 (GRCm39) P429Q probably damaging Het
Wipi1 A G 11: 109,502,137 (GRCm39) M1T probably null Het
Zfp438 A G 18: 5,214,712 (GRCm39) V82A probably damaging Het
Zfp853 G C 5: 143,273,493 (GRCm39) A724G unknown Het
Other mutations in Hsd3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Hsd3b3 APN 3 98,649,216 (GRCm39) missense probably benign 0.09
IGL01776:Hsd3b3 APN 3 98,651,163 (GRCm39) missense probably benign 0.05
IGL02189:Hsd3b3 APN 3 98,649,454 (GRCm39) missense probably benign
R0689:Hsd3b3 UTSW 3 98,649,295 (GRCm39) missense possibly damaging 0.76
R0893:Hsd3b3 UTSW 3 98,649,757 (GRCm39) splice site probably null
R1759:Hsd3b3 UTSW 3 98,649,399 (GRCm39) missense probably damaging 0.96
R2008:Hsd3b3 UTSW 3 98,649,408 (GRCm39) missense probably damaging 1.00
R3931:Hsd3b3 UTSW 3 98,649,492 (GRCm39) missense probably damaging 1.00
R4614:Hsd3b3 UTSW 3 98,649,396 (GRCm39) missense probably benign 0.03
R4664:Hsd3b3 UTSW 3 98,649,532 (GRCm39) missense probably damaging 1.00
R4749:Hsd3b3 UTSW 3 98,649,931 (GRCm39) missense probably damaging 1.00
R4766:Hsd3b3 UTSW 3 98,649,801 (GRCm39) missense probably damaging 1.00
R4876:Hsd3b3 UTSW 3 98,649,960 (GRCm39) missense probably damaging 1.00
R5074:Hsd3b3 UTSW 3 98,649,340 (GRCm39) missense possibly damaging 0.94
R5622:Hsd3b3 UTSW 3 98,649,524 (GRCm39) missense possibly damaging 0.79
R6280:Hsd3b3 UTSW 3 98,660,621 (GRCm39) splice site probably null
R6348:Hsd3b3 UTSW 3 98,663,265 (GRCm39) splice site probably null
R7070:Hsd3b3 UTSW 3 98,649,787 (GRCm39) missense possibly damaging 0.64
R7747:Hsd3b3 UTSW 3 98,651,214 (GRCm39) missense possibly damaging 0.76
R8054:Hsd3b3 UTSW 3 98,649,331 (GRCm39) missense probably damaging 1.00
R8553:Hsd3b3 UTSW 3 98,651,205 (GRCm39) missense possibly damaging 0.87
R9130:Hsd3b3 UTSW 3 98,651,211 (GRCm39) missense possibly damaging 0.94
R9164:Hsd3b3 UTSW 3 98,660,689 (GRCm39) missense probably benign 0.00
R9333:Hsd3b3 UTSW 3 98,649,216 (GRCm39) missense probably benign 0.09
Z1176:Hsd3b3 UTSW 3 98,651,276 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCACCTGGAATTGAGGCAG -3'
(R):5'- GGTCTGACCCATACCCATACAG -3'

Sequencing Primer
(F):5'- GAAGCCCCACTCCTTGCTCAG -3'
(R):5'- CCATACAGCAAAAAGATGGCTG -3'
Posted On 2019-06-26