Mutagenetix > Incidental Mutation

Incidental Mutation 'R7283:Runx1t1'

565782

Institutional Source

Beutler Lab

Gene Symbol

Runx1t1

Ensembl Gene

ENSMUSG00000006586

Gene Name

runt-related transcription factor 1; translocated to, 1 (cyclin D-related)

Synonyms

Cbfa2t1h, ETO, MTG8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.782) question?

Stock #

R7283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13743436-13893649 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 13846935 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 240 (G240R)

Ref Sequence

ENSEMBL: ENSMUSP00000095857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006761] [ENSMUST00000098256] [ENSMUST00000098257] [ENSMUST00000105566]

AlphaFold

Q61909

Predicted Effect

probably damaging
Transcript: ENSMUST00000006761
AA Change: G220R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006761
Gene: ENSMUSG00000006586
AA Change: G220R

Domain	Start	End	E-Value	Type
low complexity region	32	48	N/A	INTRINSIC
low complexity region	68	96	N/A	INTRINSIC
TAFH	102	192	1.12e-53	SMART
low complexity region	266	277	N/A	INTRINSIC
Pfam:NHR2	317	383	6.9e-42	PFAM
SCOP:d1gpua1	384	454	7e-3	SMART
PDB:2KYG\|C	417	447	2e-12	PDB
Pfam:zf-MYND	495	531	4e-10	PFAM
low complexity region	543	558	N/A	INTRINSIC
low complexity region	562	583	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098256
AA Change: G213R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095856
Gene: ENSMUSG00000006586
AA Change: G213R

Domain	Start	End	E-Value	Type
low complexity region	25	41	N/A	INTRINSIC
low complexity region	61	89	N/A	INTRINSIC
TAFH	95	185	1.12e-53	SMART
low complexity region	259	270	N/A	INTRINSIC
Pfam:NHR2	310	376	7.3e-42	PFAM
SCOP:d1gpua1	377	447	7e-3	SMART
PDB:2KYG\|C	410	440	2e-12	PDB
Pfam:zf-MYND	488	524	2.5e-10	PFAM
low complexity region	536	551	N/A	INTRINSIC
low complexity region	555	576	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098257
AA Change: G240R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095857
Gene: ENSMUSG00000006586
AA Change: G240R

Domain	Start	End	E-Value	Type
low complexity region	52	68	N/A	INTRINSIC
low complexity region	88	116	N/A	INTRINSIC
TAFH	122	212	1.12e-53	SMART
low complexity region	286	297	N/A	INTRINSIC
Pfam:NHR2	337	403	5.2e-43	PFAM
SCOP:d1gpua1	404	474	7e-3	SMART
PDB:2KYG\|C	437	467	2e-12	PDB
Pfam:zf-MYND	515	551	6.7e-10	PFAM
low complexity region	563	578	N/A	INTRINSIC
low complexity region	582	603	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105566
AA Change: G240R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127109
Gene: ENSMUSG00000006586
AA Change: G240R

Domain	Start	End	E-Value	Type
low complexity region	52	68	N/A	INTRINSIC
low complexity region	88	116	N/A	INTRINSIC
TAFH	122	212	1.12e-53	SMART
low complexity region	286	297	N/A	INTRINSIC
Pfam:NHR2	337	403	3.6e-42	PFAM
SCOP:d1gpua1	404	474	7e-3	SMART
PDB:2KYG\|C	437	467	2e-12	PDB
Pfam:zf-MYND	515	551	1.4e-10	PFAM
low complexity region	563	578	N/A	INTRINSIC
low complexity region	582	603	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous disruption of this gene results in increased perinatal lethality and surviving animals show severe growth retardation. The midgut is absent in 25% of mutant animals which could explain increased perinatal mortality. Surviving animals display thinned intestinal walls and dilated lumens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,274,828	Q1346R	probably damaging	Het
4833439L19Rik	A	G	13: 54,552,691	V278A	probably benign	Het
4932415D10Rik	G	A	10: 82,291,297	R1960W	possibly damaging	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abce1	C	A	8: 79,685,256	G592*	probably null	Het
Acad10	A	C	5: 121,649,475	V137G	possibly damaging	Het
Adcy3	A	G	12: 4,203,563	I672V	not run	Het
Adgrb1	A	T	15: 74,580,663	Q1166L	possibly damaging	Het
Ankrd44	A	T	1: 54,729,796	N465K	probably damaging	Het
Avpr1b	A	G	1: 131,609,731	T418A	probably benign	Het
Azin1	G	A	15: 38,501,408	T33I	probably damaging	Het
Bicra	T	C	7: 15,972,500	T1339A	probably damaging	Het
Cacna1s	A	G	1: 136,073,708	Y299C	probably damaging	Het
Clip1	A	C	5: 123,613,794	C641W		Het
Clip3	T	C	7: 30,305,812	S524P	probably damaging	Het
Cnpy4	A	T	5: 138,192,882	H240L	probably benign	Het
Cyp2b19	T	C	7: 26,766,914	Y381H	probably damaging	Het
Cyp3a13	T	A	5: 137,905,556	N280I	probably benign	Het
Diaph3	A	G	14: 86,866,584	F788S	probably damaging	Het
Drc7	A	G	8: 95,071,579	N484S	probably damaging	Het
Erap1	G	A	13: 74,673,784		probably null	Het
Fat4	A	T	3: 38,889,693	I912F	probably damaging	Het
Hsd3b3	T	A	3: 98,742,357	K217*	probably null	Het
Igkv12-89	A	G	6: 68,835,077	V36A	probably damaging	Het
Invs	T	A	4: 48,392,526		probably null	Het
Ipo8	T	A	6: 148,824,481	Y30F	possibly damaging	Het
Kctd14	T	C	7: 97,451,486	M1T	probably null	Het
Klrb1c	A	T	6: 128,784,257	C136S	probably benign	Het
Morn2	A	G	17: 80,297,259	E48G	probably damaging	Het
Myh1	A	T	11: 67,201,844		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nfxl1	A	G	5: 72,529,050	S603P	probably benign	Het
Nlrc3	G	A	16: 3,947,877	A351V	probably benign	Het
Nlrp4f	G	A	13: 65,195,538	R76*	probably null	Het
Olfr190	A	T	16: 59,074,192	M296K	probably benign	Het
Olfr228	A	T	2: 86,483,139	I201N	probably damaging	Het
Olfr397	T	C	11: 73,964,808	S67P	probably damaging	Het
Olfr664	G	T	7: 104,733,593	T257K	probably damaging	Het
Olfr872	A	C	9: 20,260,259	I140L	probably damaging	Het
Papolg	A	G	11: 23,867,394	V601A	not run	Het
Pde4dip	T	C	3: 97,758,882	T349A	probably benign	Het
Pdlim5	T	C	3: 142,311,980		probably null	Het
Pkhd1l1	A	G	15: 44,503,280	N718S	probably benign	Het
Plcxd3	A	G	15: 4,516,919	H135R	probably damaging	Het
Plxna2	A	T	1: 194,644,883	Y375F	probably damaging	Het
Prkca	C	T	11: 108,340,645		probably null	Het
Prkdc	A	G	16: 15,717,764	S1663G	probably benign	Het
Ptbp3	T	C	4: 59,514,384	T80A	probably benign	Het
Ptpn4	C	T	1: 119,682,531	V696I	possibly damaging	Het
Pygl	A	T	12: 70,216,568	W175R	possibly damaging	Het
Rftn1	A	G	17: 50,047,441	Y298H	probably damaging	Het
Rit2	A	G	18: 31,316,839		probably null	Het
Scn10a	A	G	9: 119,664,779		probably null	Het
Serpina16	A	C	12: 103,672,432		probably null	Het
Slc17a3	A	T	13: 23,855,848	M290L		Het
Slc6a4	A	T	11: 77,010,696	M86L	probably benign	Het
Spag7	A	T	11: 70,665,313	V46E	probably benign	Het
Sptlc1	T	C	13: 53,344,878	I271V	probably benign	Het
Stk17b	A	C	1: 53,757,515	H364Q	probably benign	Het
Strc	T	C	2: 121,379,452	H130R	probably damaging	Het
Stxbp1	T	A	2: 32,815,014	D148V	probably damaging	Het
Tirap	G	A	9: 35,188,929	P153L	probably damaging	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tmem51	T	A	4: 142,031,783	D218V	probably damaging	Het
Trim40	A	T	17: 36,882,662	D218E	probably benign	Het
Ttc21b	T	C	2: 66,208,718	D934G	probably damaging	Het
Vmn2r26	T	C	6: 124,025,955	L108P	probably damaging	Het
Washc2	C	A	6: 116,227,418	P429Q	probably damaging	Het
Wipi1	A	G	11: 109,611,311	M1T	probably null	Het
Zfp438	A	G	18: 5,214,712	V82A	probably damaging	Het
Zfp853	G	C	5: 143,287,738	A724G	unknown	Het

Other mutations in Runx1t1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Runx1t1	APN	4	13835663	missense	probably benign	0.07
IGL01600:Runx1t1	APN	4	13841871	missense	probably damaging	1.00
IGL02120:Runx1t1	APN	4	13846884	missense	probably benign
IGL02172:Runx1t1	APN	4	13859924	missense	probably benign	0.00
IGL02429:Runx1t1	APN	4	13865294	splice site	probably benign
IGL02730:Runx1t1	APN	4	13860019	missense	probably benign	0.01
IGL02870:Runx1t1	APN	4	13889867	missense	unknown
IGL02879:Runx1t1	APN	4	13889868	missense	unknown
IGL03369:Runx1t1	APN	4	13881107	missense	probably damaging	1.00
IGL03047:Runx1t1	UTSW	4	13865882	missense	probably damaging	1.00
R1832:Runx1t1	UTSW	4	13835628	splice site	probably benign
R1884:Runx1t1	UTSW	4	13835767	missense	probably benign	0.00
R2277:Runx1t1	UTSW	4	13771501	missense	probably benign	0.00
R4059:Runx1t1	UTSW	4	13889769	missense	probably benign	0.33
R4505:Runx1t1	UTSW	4	13889676	missense	probably damaging	1.00
R4585:Runx1t1	UTSW	4	13889864	missense	unknown
R4586:Runx1t1	UTSW	4	13889864	missense	unknown
R4758:Runx1t1	UTSW	4	13865907	missense	probably damaging	1.00
R4795:Runx1t1	UTSW	4	13837767	missense	probably damaging	0.99
R4796:Runx1t1	UTSW	4	13837767	missense	probably damaging	0.99
R4897:Runx1t1	UTSW	4	13771459	start codon destroyed	probably null	0.01
R4971:Runx1t1	UTSW	4	13837978	missense	probably damaging	1.00
R5009:Runx1t1	UTSW	4	13865231	missense	possibly damaging	0.80
R5091:Runx1t1	UTSW	4	13846830	nonsense	probably null
R5844:Runx1t1	UTSW	4	13881068	missense	probably damaging	1.00
R5968:Runx1t1	UTSW	4	13841890	splice site	probably null
R5993:Runx1t1	UTSW	4	13841863	missense	probably damaging	0.98
R5993:Runx1t1	UTSW	4	13875490	missense	probably benign	0.00
R6329:Runx1t1	UTSW	4	13785136	start codon destroyed	probably null	0.38
R6915:Runx1t1	UTSW	4	13865257	missense	probably damaging	0.99
R8251:Runx1t1	UTSW	4	13846947	missense	possibly damaging	0.46
R9301:Runx1t1	UTSW	4	13875477	missense	possibly damaging	0.78
R9376:Runx1t1	UTSW	4	13865225	missense	possibly damaging	0.93
R9390:Runx1t1	UTSW	4	13865932	missense	probably benign	0.14
Z1088:Runx1t1	UTSW	4	13865892	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- CAGGCTTTGACTGTCCCATC -3'
(R):5'- TCTGCACAAAAGCTGCCCAG -3'

Sequencing Primer
(F):5'- AGGCTTTGACTGTCCCATCTTATG -3'
(R):5'- CAGAGCAGAGACTCACTTCTC -3'

Posted On

2019-06-26