Incidental Mutation 'R7283:Ptbp3'
ID 565783
Institutional Source Beutler Lab
Gene Symbol Ptbp3
Ensembl Gene ENSMUSG00000028382
Gene Name polypyrimidine tract binding protein 3
Synonyms Rod1, 5830471K22Rik
MMRRC Submission 045361-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.365) question?
Stock # R7283 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 59471868-59549288 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59514384 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 80 (T80A)
Ref Sequence ENSEMBL: ENSMUSP00000030076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030076] [ENSMUST00000102883] [ENSMUST00000134879] [ENSMUST00000140925] [ENSMUST00000148331] [ENSMUST00000172768] [ENSMUST00000173699] [ENSMUST00000173884] [ENSMUST00000174586] [ENSMUST00000174748]
AlphaFold Q8BHD7
Predicted Effect probably benign
Transcript: ENSMUST00000030076
AA Change: T80A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030076
Gene: ENSMUSG00000028382
AA Change: T80A

DomainStartEndE-ValueType
RRM 31 100 2.24e-3 SMART
low complexity region 115 130 N/A INTRINSIC
RRM 154 223 2.51e-6 SMART
low complexity region 277 293 N/A INTRINSIC
RRM 330 399 2.13e-9 SMART
RRM 447 517 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102883
AA Change: T108A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099947
Gene: ENSMUSG00000028382
AA Change: T108A

DomainStartEndE-ValueType
RRM 59 128 2.24e-3 SMART
low complexity region 143 158 N/A INTRINSIC
RRM 182 251 2.51e-6 SMART
low complexity region 305 321 N/A INTRINSIC
RRM 358 427 2.13e-9 SMART
RRM 475 545 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134879
Predicted Effect probably benign
Transcript: ENSMUST00000140925
SMART Domains Protein: ENSMUSP00000122138
Gene: ENSMUSG00000028382

DomainStartEndE-ValueType
SCOP:d1qm9a2 53 99 2e-4 SMART
PDB:2CQ1|A 54 101 8e-19 PDB
Blast:RRM 64 100 4e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148331
AA Change: T77A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122840
Gene: ENSMUSG00000028382
AA Change: T77A

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172768
AA Change: T77A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134102
Gene: ENSMUSG00000028382
AA Change: T77A

DomainStartEndE-ValueType
RRM 28 97 2.24e-3 SMART
low complexity region 112 127 N/A INTRINSIC
RRM 151 220 2.51e-6 SMART
low complexity region 274 290 N/A INTRINSIC
RRM 327 396 2.13e-9 SMART
RRM 444 514 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173699
AA Change: T14A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134290
Gene: ENSMUSG00000028382
AA Change: T14A

DomainStartEndE-ValueType
PDB:2CQ1|A 2 44 7e-18 PDB
low complexity region 49 64 N/A INTRINSIC
RRM 88 157 2.51e-6 SMART
low complexity region 211 227 N/A INTRINSIC
RRM 264 333 2.13e-9 SMART
RRM 381 451 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173884
SMART Domains Protein: ENSMUSP00000133996
Gene: ENSMUSG00000028382

DomainStartEndE-ValueType
low complexity region 16 28 N/A INTRINSIC
RRM 52 121 2.51e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174586
AA Change: T111A

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133612
Gene: ENSMUSG00000028382
AA Change: T111A

DomainStartEndE-ValueType
RRM 62 131 2.24e-3 SMART
low complexity region 146 161 N/A INTRINSIC
RRM 185 254 2.51e-6 SMART
low complexity region 308 324 N/A INTRINSIC
RRM 361 430 2.13e-9 SMART
RRM 478 548 1.29e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174748
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds RNA and is a regulator of cell differentiation. The encoded protein preferentially binds to poly(G) and poly(U) sequences in vitro. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,700,504 (GRCm39) V278A probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abce1 C A 8: 80,411,885 (GRCm39) G592* probably null Het
Acad10 A C 5: 121,787,538 (GRCm39) V137G possibly damaging Het
Adcy3 A G 12: 4,253,563 (GRCm39) I672V not run Het
Adgrb1 A T 15: 74,452,512 (GRCm39) Q1166L possibly damaging Het
Ankrd44 A T 1: 54,768,955 (GRCm39) N465K probably damaging Het
Avpr1b A G 1: 131,537,469 (GRCm39) T418A probably benign Het
Azin1 G A 15: 38,501,652 (GRCm39) T33I probably damaging Het
Bicra T C 7: 15,706,425 (GRCm39) T1339A probably damaging Het
Bltp2 A G 11: 78,165,654 (GRCm39) Q1346R probably damaging Het
Cacna1s A G 1: 136,001,446 (GRCm39) Y299C probably damaging Het
Clip1 A C 5: 123,751,857 (GRCm39) C641W Het
Clip3 T C 7: 30,005,237 (GRCm39) S524P probably damaging Het
Cnpy4 A T 5: 138,191,144 (GRCm39) H240L probably benign Het
Cyp2b19 T C 7: 26,466,339 (GRCm39) Y381H probably damaging Het
Cyp3a13 T A 5: 137,903,818 (GRCm39) N280I probably benign Het
Diaph3 A G 14: 87,104,020 (GRCm39) F788S probably damaging Het
Drc7 A G 8: 95,798,207 (GRCm39) N484S probably damaging Het
Erap1 G A 13: 74,821,903 (GRCm39) probably null Het
Fat4 A T 3: 38,943,842 (GRCm39) I912F probably damaging Het
Hsd3b3 T A 3: 98,649,673 (GRCm39) K217* probably null Het
Igkv12-89 A G 6: 68,812,061 (GRCm39) V36A probably damaging Het
Invs T A 4: 48,392,526 (GRCm39) probably null Het
Ipo8 T A 6: 148,725,979 (GRCm39) Y30F possibly damaging Het
Kctd14 T C 7: 97,100,693 (GRCm39) M1T probably null Het
Klrb1c A T 6: 128,761,220 (GRCm39) C136S probably benign Het
Morn2 A G 17: 80,604,688 (GRCm39) E48G probably damaging Het
Myh1 A T 11: 67,092,670 (GRCm39) probably null Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nfxl1 A G 5: 72,686,393 (GRCm39) S603P probably benign Het
Nlrc3 G A 16: 3,765,741 (GRCm39) A351V probably benign Het
Nlrp4f G A 13: 65,343,352 (GRCm39) R76* probably null Het
Or1e1f T C 11: 73,855,634 (GRCm39) S67P probably damaging Het
Or52n1 G T 7: 104,382,800 (GRCm39) T257K probably damaging Het
Or5h22 A T 16: 58,894,555 (GRCm39) M296K probably benign Het
Or7e176 A C 9: 20,171,555 (GRCm39) I140L probably damaging Het
Or8k41 A T 2: 86,313,483 (GRCm39) I201N probably damaging Het
Papolg A G 11: 23,817,394 (GRCm39) V601A not run Het
Pde4dip T C 3: 97,666,198 (GRCm39) T349A probably benign Het
Pdlim5 T C 3: 142,017,741 (GRCm39) probably null Het
Pkhd1l1 A G 15: 44,366,676 (GRCm39) N718S probably benign Het
Plcxd3 A G 15: 4,546,401 (GRCm39) H135R probably damaging Het
Plxna2 A T 1: 194,327,191 (GRCm39) Y375F probably damaging Het
Prkca C T 11: 108,231,471 (GRCm39) probably null Het
Prkdc A G 16: 15,535,628 (GRCm39) S1663G probably benign Het
Ptpn4 C T 1: 119,610,261 (GRCm39) V696I possibly damaging Het
Pygl A T 12: 70,263,342 (GRCm39) W175R possibly damaging Het
Rftn1 A G 17: 50,354,469 (GRCm39) Y298H probably damaging Het
Rit2 A G 18: 31,449,892 (GRCm39) probably null Het
Runx1t1 G A 4: 13,846,935 (GRCm39) G240R probably damaging Het
Scn10a A G 9: 119,493,845 (GRCm39) probably null Het
Serpina16 A C 12: 103,638,691 (GRCm39) probably null Het
Slc17a3 A T 13: 24,039,831 (GRCm39) M290L Het
Slc6a4 A T 11: 76,901,522 (GRCm39) M86L probably benign Het
Spag7 A T 11: 70,556,139 (GRCm39) V46E probably benign Het
Spata31h1 G A 10: 82,127,131 (GRCm39) R1960W possibly damaging Het
Sptlc1 T C 13: 53,498,914 (GRCm39) I271V probably benign Het
Stk17b A C 1: 53,796,674 (GRCm39) H364Q probably benign Het
Strc T C 2: 121,209,933 (GRCm39) H130R probably damaging Het
Stxbp1 T A 2: 32,705,026 (GRCm39) D148V probably damaging Het
Tirap G A 9: 35,100,225 (GRCm39) P153L probably damaging Het
Tmco3 G A 8: 13,369,605 (GRCm39) probably null Het
Tmem51 T A 4: 141,759,094 (GRCm39) D218V probably damaging Het
Trim40 A T 17: 37,193,554 (GRCm39) D218E probably benign Het
Ttc21b T C 2: 66,039,062 (GRCm39) D934G probably damaging Het
Vmn2r26 T C 6: 124,002,914 (GRCm39) L108P probably damaging Het
Washc2 C A 6: 116,204,379 (GRCm39) P429Q probably damaging Het
Wipi1 A G 11: 109,502,137 (GRCm39) M1T probably null Het
Zfp438 A G 18: 5,214,712 (GRCm39) V82A probably damaging Het
Zfp853 G C 5: 143,273,493 (GRCm39) A724G unknown Het
Other mutations in Ptbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Ptbp3 APN 4 59,477,228 (GRCm39) missense probably benign 0.29
IGL03035:Ptbp3 APN 4 59,477,218 (GRCm39) missense probably benign 0.00
IGL03118:Ptbp3 APN 4 59,501,470 (GRCm39) missense probably benign 0.03
IGL03257:Ptbp3 APN 4 59,493,370 (GRCm39) splice site probably benign
IGL03279:Ptbp3 APN 4 59,476,937 (GRCm39) missense possibly damaging 0.68
R0557:Ptbp3 UTSW 4 59,517,684 (GRCm39) nonsense probably null
R1741:Ptbp3 UTSW 4 59,482,624 (GRCm39) missense probably damaging 0.98
R1914:Ptbp3 UTSW 4 59,517,635 (GRCm39) missense probably damaging 1.00
R1915:Ptbp3 UTSW 4 59,517,635 (GRCm39) missense probably damaging 1.00
R2679:Ptbp3 UTSW 4 59,494,615 (GRCm39) splice site probably benign
R3798:Ptbp3 UTSW 4 59,546,166 (GRCm39) missense probably benign 0.05
R4793:Ptbp3 UTSW 4 59,514,297 (GRCm39) missense possibly damaging 0.71
R4869:Ptbp3 UTSW 4 59,524,443 (GRCm39) missense possibly damaging 0.79
R5573:Ptbp3 UTSW 4 59,485,626 (GRCm39) missense probably damaging 1.00
R5986:Ptbp3 UTSW 4 59,493,311 (GRCm39) missense probably benign 0.37
R6350:Ptbp3 UTSW 4 59,482,624 (GRCm39) missense probably damaging 0.98
R6659:Ptbp3 UTSW 4 59,517,640 (GRCm39) missense probably damaging 1.00
R7523:Ptbp3 UTSW 4 59,546,159 (GRCm39) missense probably benign
R7566:Ptbp3 UTSW 4 59,514,280 (GRCm39) missense probably benign 0.03
R8807:Ptbp3 UTSW 4 59,517,584 (GRCm39) missense probably benign
YA93:Ptbp3 UTSW 4 59,524,413 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CAGCCCAGTGTCATTTCTAACAC -3'
(R):5'- CCTGGCAGTTTCCTCAGTTG -3'

Sequencing Primer
(F):5'- GTGTCATTTCTAACACTACAACTTCC -3'
(R):5'- CAGTTGGAAACTTTTATTGAACCCAG -3'
Posted On 2019-06-26