Mutagenetix > Incidental Mutation

Incidental Mutation 'R7283:Clip1'

565787

Institutional Source

Beutler Lab

Gene Symbol

Clip1

Ensembl Gene

ENSMUSG00000049550

Gene Name

CAP-GLY domain containing linker protein 1

Synonyms

Clip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123577795-123684618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 123613794 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tryptophan at position 641 (C641W)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566] [ENSMUST00000149410]

AlphaFold

Q922J3

Predicted Effect

probably benign
Transcript: ENSMUST00000031382

SMART Domains

Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.28e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.28e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	451	N/A	INTRINSIC
coiled coil region	474	535	N/A	INTRINSIC
coiled coil region	581	620	N/A	INTRINSIC
coiled coil region	652	1352	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1375	1392	5.8e-9	PFAM
ZnF_C2HC	1417	1433	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000063905

SMART Domains

Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	3.3e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	3.3e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1075	N/A	INTRINSIC
coiled coil region	1115	1235	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
ZnF_C2HC	1300	1316	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111561

SMART Domains

Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	1.93e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	1.93e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1341	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
ZnF_C2HC	1406	1422	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111564

SMART Domains

Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.5e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.5e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1230	N/A	INTRINSIC
low complexity region	1240	1251	N/A	INTRINSIC
ZnF_C2HC	1295	1311	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111566

SMART Domains

Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1306	N/A	INTRINSIC
low complexity region	1316	1327	N/A	INTRINSIC
ZnF_C2HC	1371	1387	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000137363

SMART Domains

Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
CAP_GLY	2	31	2.59e0	SMART
low complexity region	39	57	N/A	INTRINSIC
low complexity region	58	84	N/A	INTRINSIC
coiled coil region	101	276	N/A	INTRINSIC
coiled coil region	322	361	N/A	INTRINSIC
coiled coil region	393	980	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1004	1021	4.2e-9	PFAM
ZnF_C2HC	1046	1062	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000144121

SMART Domains

Protein: ENSMUSP00000119641
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
CAP_GLY	37	102	1.05e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149410

SMART Domains

Protein: ENSMUSP00000115965
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
low complexity region	26	32	N/A	INTRINSIC
CAP_GLY	60	125	1.05e-31	SMART
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	334	458	N/A	INTRINSIC
coiled coil region	504	543	N/A	INTRINSIC
coiled coil region	575	827	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122064
Gene: ENSMUSG00000049550
AA Change: C641W

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
low complexity region	165	176	N/A	INTRINSIC
internal_repeat_1	352	375	1.56e-8	PROSPERO
internal_repeat_3	358	377	5.32e-6	PROSPERO
internal_repeat_1	450	473	1.56e-8	PROSPERO
internal_repeat_3	544	563	5.32e-6	PROSPERO
internal_repeat_2	553	575	2.88e-7	PROSPERO
low complexity region	735	744	N/A	INTRINSIC
internal_repeat_2	781	803	2.88e-7	PROSPERO
low complexity region	819	830	N/A	INTRINSIC
low complexity region	962	977	N/A	INTRINSIC
low complexity region	1081	1099	N/A	INTRINSIC
low complexity region	1110	1121	N/A	INTRINSIC
low complexity region	1164	1175	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,274,828	Q1346R	probably damaging	Het
4833439L19Rik	A	G	13: 54,552,691	V278A	probably benign	Het
4932415D10Rik	G	A	10: 82,291,297	R1960W	possibly damaging	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abce1	C	A	8: 79,685,256	G592*	probably null	Het
Acad10	A	C	5: 121,649,475	V137G	possibly damaging	Het
Adcy3	A	G	12: 4,203,563	I672V	not run	Het
Adgrb1	A	T	15: 74,580,663	Q1166L	possibly damaging	Het
Ankrd44	A	T	1: 54,729,796	N465K	probably damaging	Het
Avpr1b	A	G	1: 131,609,731	T418A	probably benign	Het
Azin1	G	A	15: 38,501,408	T33I	probably damaging	Het
Bicra	T	C	7: 15,972,500	T1339A	probably damaging	Het
Cacna1s	A	G	1: 136,073,708	Y299C	probably damaging	Het
Clip3	T	C	7: 30,305,812	S524P	probably damaging	Het
Cnpy4	A	T	5: 138,192,882	H240L	probably benign	Het
Cyp2b19	T	C	7: 26,766,914	Y381H	probably damaging	Het
Cyp3a13	T	A	5: 137,905,556	N280I	probably benign	Het
Diaph3	A	G	14: 86,866,584	F788S	probably damaging	Het
Drc7	A	G	8: 95,071,579	N484S	probably damaging	Het
Erap1	G	A	13: 74,673,784		probably null	Het
Fat4	A	T	3: 38,889,693	I912F	probably damaging	Het
Hsd3b3	T	A	3: 98,742,357	K217*	probably null	Het
Igkv12-89	A	G	6: 68,835,077	V36A	probably damaging	Het
Invs	T	A	4: 48,392,526		probably null	Het
Ipo8	T	A	6: 148,824,481	Y30F	possibly damaging	Het
Kctd14	T	C	7: 97,451,486	M1T	probably null	Het
Klrb1c	A	T	6: 128,784,257	C136S	probably benign	Het
Morn2	A	G	17: 80,297,259	E48G	probably damaging	Het
Myh1	A	T	11: 67,201,844		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nfxl1	A	G	5: 72,529,050	S603P	probably benign	Het
Nlrc3	G	A	16: 3,947,877	A351V	probably benign	Het
Nlrp4f	G	A	13: 65,195,538	R76*	probably null	Het
Olfr190	A	T	16: 59,074,192	M296K	probably benign	Het
Olfr228	A	T	2: 86,483,139	I201N	probably damaging	Het
Olfr397	T	C	11: 73,964,808	S67P	probably damaging	Het
Olfr664	G	T	7: 104,733,593	T257K	probably damaging	Het
Olfr872	A	C	9: 20,260,259	I140L	probably damaging	Het
Papolg	A	G	11: 23,867,394	V601A	not run	Het
Pde4dip	T	C	3: 97,758,882	T349A	probably benign	Het
Pdlim5	T	C	3: 142,311,980		probably null	Het
Pkhd1l1	A	G	15: 44,503,280	N718S	probably benign	Het
Plcxd3	A	G	15: 4,516,919	H135R	probably damaging	Het
Plxna2	A	T	1: 194,644,883	Y375F	probably damaging	Het
Prkca	C	T	11: 108,340,645		probably null	Het
Prkdc	A	G	16: 15,717,764	S1663G	probably benign	Het
Ptbp3	T	C	4: 59,514,384	T80A	probably benign	Het
Ptpn4	C	T	1: 119,682,531	V696I	possibly damaging	Het
Pygl	A	T	12: 70,216,568	W175R	possibly damaging	Het
Rftn1	A	G	17: 50,047,441	Y298H	probably damaging	Het
Rit2	A	G	18: 31,316,839		probably null	Het
Runx1t1	G	A	4: 13,846,935	G240R	probably damaging	Het
Scn10a	A	G	9: 119,664,779		probably null	Het
Serpina16	A	C	12: 103,672,432		probably null	Het
Slc17a3	A	T	13: 23,855,848	M290L		Het
Slc6a4	A	T	11: 77,010,696	M86L	probably benign	Het
Spag7	A	T	11: 70,665,313	V46E	probably benign	Het
Sptlc1	T	C	13: 53,344,878	I271V	probably benign	Het
Stk17b	A	C	1: 53,757,515	H364Q	probably benign	Het
Strc	T	C	2: 121,379,452	H130R	probably damaging	Het
Stxbp1	T	A	2: 32,815,014	D148V	probably damaging	Het
Tirap	G	A	9: 35,188,929	P153L	probably damaging	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tmem51	T	A	4: 142,031,783	D218V	probably damaging	Het
Trim40	A	T	17: 36,882,662	D218E	probably benign	Het
Ttc21b	T	C	2: 66,208,718	D934G	probably damaging	Het
Vmn2r26	T	C	6: 124,025,955	L108P	probably damaging	Het
Washc2	C	A	6: 116,227,418	P429Q	probably damaging	Het
Wipi1	A	G	11: 109,611,311	M1T	probably null	Het
Zfp438	A	G	18: 5,214,712	V82A	probably damaging	Het
Zfp853	G	C	5: 143,287,738	A724G	unknown	Het

Other mutations in Clip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Clip1	APN	5	123603654	missense	possibly damaging	0.94
IGL01067:Clip1	APN	5	123630804	missense	probably damaging	0.99
IGL01524:Clip1	APN	5	123579379	missense	probably damaging	1.00
IGL01632:Clip1	APN	5	123617496	missense	probably damaging	1.00
IGL01798:Clip1	APN	5	123583549	missense	probably damaging	1.00
IGL01874:Clip1	APN	5	123603666	missense	possibly damaging	0.50
IGL01908:Clip1	APN	5	123623207	splice site	probably benign
IGL02120:Clip1	APN	5	123647883	missense	probably damaging	1.00
IGL02309:Clip1	APN	5	123617700	missense	probably damaging	0.99
IGL02555:Clip1	APN	5	123621794	critical splice donor site	probably null
IGL03027:Clip1	APN	5	123621856	missense	probably benign	0.43
IGL03336:Clip1	APN	5	123653570	nonsense	probably null
IGL03365:Clip1	APN	5	123583586	missense	probably damaging	1.00
IGL02802:Clip1	UTSW	5	123631123	missense	probably damaging	1.00
PIT4812001:Clip1	UTSW	5	123630675	missense	probably benign	0.08
R0254:Clip1	UTSW	5	123617332	splice site	probably benign
R0401:Clip1	UTSW	5	123653789	missense	probably damaging	1.00
R0530:Clip1	UTSW	5	123640531	missense	probably damaging	1.00
R0744:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R0833:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R1116:Clip1	UTSW	5	123579491	missense	probably damaging	0.99
R1182:Clip1	UTSW	5	123647865	missense	probably damaging	1.00
R1656:Clip1	UTSW	5	123630403	missense	possibly damaging	0.61
R1700:Clip1	UTSW	5	123630370	missense	probably benign
R1889:Clip1	UTSW	5	123653496	missense	probably damaging	0.99
R1975:Clip1	UTSW	5	123623218	missense	possibly damaging	0.79
R2406:Clip1	UTSW	5	123603660	missense	probably damaging	1.00
R3545:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3547:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3548:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3911:Clip1	UTSW	5	123590834	missense	probably damaging	1.00
R3944:Clip1	UTSW	5	123617829	unclassified	probably benign
R4660:Clip1	UTSW	5	123579374	missense	probably damaging	0.98
R4784:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4785:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4824:Clip1	UTSW	5	123631023	missense	probably damaging	1.00
R4831:Clip1	UTSW	5	123583601	missense	probably damaging	1.00
R4951:Clip1	UTSW	5	123630345	missense	probably benign	0.02
R4960:Clip1	UTSW	5	123654003	nonsense	probably null
R5014:Clip1	UTSW	5	123617730	missense	probably damaging	0.99
R5116:Clip1	UTSW	5	123630707	missense	probably benign	0.05
R5212:Clip1	UTSW	5	123630681	missense	probably benign	0.09
R5238:Clip1	UTSW	5	123647883	missense	probably damaging	1.00
R5318:Clip1	UTSW	5	123613084	unclassified	probably benign
R5372:Clip1	UTSW	5	123630240	missense	probably benign	0.02
R5701:Clip1	UTSW	5	123613303	unclassified	probably benign
R5734:Clip1	UTSW	5	123615154	unclassified	probably benign
R5757:Clip1	UTSW	5	123627397	missense	probably benign	0.21
R6024:Clip1	UTSW	5	123615089	missense	possibly damaging	0.66
R6160:Clip1	UTSW	5	123613541	missense	possibly damaging	0.66
R6177:Clip1	UTSW	5	123613834	unclassified	probably benign
R6183:Clip1	UTSW	5	123642604	missense	probably damaging	1.00
R6377:Clip1	UTSW	5	123603654	missense	possibly damaging	0.50
R6436:Clip1	UTSW	5	123641785	missense	probably damaging	1.00
R6471:Clip1	UTSW	5	123640549	missense	probably damaging	0.99
R6766:Clip1	UTSW	5	123614764	unclassified	probably benign
R7015:Clip1	UTSW	5	123613612	unclassified	probably benign
R7094:Clip1	UTSW	5	123623270	missense	probably benign	0.02
R7143:Clip1	UTSW	5	123653610	missense	probably benign
R7222:Clip1	UTSW	5	123611841	missense	probably damaging	0.99
R7233:Clip1	UTSW	5	123611859	missense	probably damaging	1.00
R7238:Clip1	UTSW	5	123613265	missense
R7249:Clip1	UTSW	5	123603600	missense	probably damaging	1.00
R7295:Clip1	UTSW	5	123627356	missense	probably benign	0.19
R7447:Clip1	UTSW	5	123653633	missense	probably benign	0.03
R7458:Clip1	UTSW	5	123640546	missense	probably damaging	1.00
R7483:Clip1	UTSW	5	123617384	missense	probably benign	0.00
R7516:Clip1	UTSW	5	123583385	missense	probably benign	0.00
R7619:Clip1	UTSW	5	123614279	missense
R7831:Clip1	UTSW	5	123613279	missense
R7897:Clip1	UTSW	5	123622798	missense	probably benign
R8155:Clip1	UTSW	5	123613636	missense
R8157:Clip1	UTSW	5	123630719	missense	probably benign	0.17
R8232:Clip1	UTSW	5	123647918	missense	probably benign	0.05
R8396:Clip1	UTSW	5	123642564	missense	probably damaging	1.00
R8446:Clip1	UTSW	5	123655945	missense	probably damaging	1.00
R8486:Clip1	UTSW	5	123614707	unclassified	probably benign
R8511:Clip1	UTSW	5	123653906	missense	possibly damaging	0.50
R8731:Clip1	UTSW	5	123614693	missense
R8889:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R8892:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R9058:Clip1	UTSW	5	123614582	missense
R9106:Clip1	UTSW	5	123615160	missense	probably damaging	0.97
R9212:Clip1	UTSW	5	123583336	missense	probably damaging	1.00
R9217:Clip1	UTSW	5	123579378	missense	probably damaging	1.00
R9223:Clip1	UTSW	5	123646274	missense	probably damaging	1.00
R9325:Clip1	UTSW	5	123613123	missense
R9752:Clip1	UTSW	5	123621946	missense	probably damaging	1.00
Z1177:Clip1	UTSW	5	123617350	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCCTCCAGGAGCACTACTC -3'
(R):5'- ACAGGCGGATTGTTATGCAGG -3'

Sequencing Primer
(F):5'- GGAGCACTACTCTCCCATGG -3'
(R):5'- TGAAGCTGCTCGGTAACATC -3'

Posted On

2019-06-26