Mutagenetix > Incidental Mutation

Incidental Mutation 'R7283:Bicra'

565796

Institutional Source

Beutler Lab

Gene Symbol

Bicra

Ensembl Gene

ENSMUSG00000070808

Gene Name

BRD4 interacting chromatin remodeling complex associated protein

Synonyms

Gltscr1

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R7283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15970672-16047921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 15972500 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1339 (T1339A)

Ref Sequence

ENSEMBL: ENSMUSP00000092416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000098799] [ENSMUST00000210781]

AlphaFold

F8VPZ9

Predicted Effect

probably damaging
Transcript: ENSMUST00000094821
AA Change: T1339A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: T1339A

Domain	Start	End	E-Value	Type
low complexity region	86	96	N/A	INTRINSIC
low complexity region	140	155	N/A	INTRINSIC
internal_repeat_1	156	298	1.03e-6	PROSPERO
low complexity region	308	323	N/A	INTRINSIC
low complexity region	427	443	N/A	INTRINSIC
internal_repeat_1	479	614	1.03e-6	PROSPERO
low complexity region	619	638	N/A	INTRINSIC
low complexity region	642	676	N/A	INTRINSIC
low complexity region	719	732	N/A	INTRINSIC
low complexity region	756	782	N/A	INTRINSIC
low complexity region	790	819	N/A	INTRINSIC
low complexity region	827	843	N/A	INTRINSIC
low complexity region	852	906	N/A	INTRINSIC
low complexity region	940	950	N/A	INTRINSIC
low complexity region	987	1006	N/A	INTRINSIC
Pfam:GLTSCR1	1094	1202	4.6e-43	PFAM
low complexity region	1232	1251	N/A	INTRINSIC
low complexity region	1275	1294	N/A	INTRINSIC
low complexity region	1349	1371	N/A	INTRINSIC
low complexity region	1460	1473	N/A	INTRINSIC
low complexity region	1535	1555	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098799

SMART Domains

Protein: ENSMUSP00000096397
Gene: ENSMUSG00000074364

Domain	Start	End	E-Value	Type
Pfam:EHD_N	24	56	4.1e-19	PFAM
Pfam:MMR_HSR1	60	220	2.2e-7	PFAM
Pfam:Dynamin_N	61	221	2.4e-14	PFAM
EH	443	536	2.96e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000210781
AA Change: T1339A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (72/72)

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,274,828	Q1346R	probably damaging	Het
4833439L19Rik	A	G	13: 54,552,691	V278A	probably benign	Het
4932415D10Rik	G	A	10: 82,291,297	R1960W	possibly damaging	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abce1	C	A	8: 79,685,256	G592*	probably null	Het
Acad10	A	C	5: 121,649,475	V137G	possibly damaging	Het
Adcy3	A	G	12: 4,203,563	I672V	not run	Het
Adgrb1	A	T	15: 74,580,663	Q1166L	possibly damaging	Het
Ankrd44	A	T	1: 54,729,796	N465K	probably damaging	Het
Avpr1b	A	G	1: 131,609,731	T418A	probably benign	Het
Azin1	G	A	15: 38,501,408	T33I	probably damaging	Het
Cacna1s	A	G	1: 136,073,708	Y299C	probably damaging	Het
Clip1	A	C	5: 123,613,794	C641W		Het
Clip3	T	C	7: 30,305,812	S524P	probably damaging	Het
Cnpy4	A	T	5: 138,192,882	H240L	probably benign	Het
Cyp2b19	T	C	7: 26,766,914	Y381H	probably damaging	Het
Cyp3a13	T	A	5: 137,905,556	N280I	probably benign	Het
Diaph3	A	G	14: 86,866,584	F788S	probably damaging	Het
Drc7	A	G	8: 95,071,579	N484S	probably damaging	Het
Erap1	G	A	13: 74,673,784		probably null	Het
Fat4	A	T	3: 38,889,693	I912F	probably damaging	Het
Hsd3b3	T	A	3: 98,742,357	K217*	probably null	Het
Igkv12-89	A	G	6: 68,835,077	V36A	probably damaging	Het
Invs	T	A	4: 48,392,526		probably null	Het
Ipo8	T	A	6: 148,824,481	Y30F	possibly damaging	Het
Kctd14	T	C	7: 97,451,486	M1T	probably null	Het
Klrb1c	A	T	6: 128,784,257	C136S	probably benign	Het
Morn2	A	G	17: 80,297,259	E48G	probably damaging	Het
Myh1	A	T	11: 67,201,844		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nfxl1	A	G	5: 72,529,050	S603P	probably benign	Het
Nlrc3	G	A	16: 3,947,877	A351V	probably benign	Het
Nlrp4f	G	A	13: 65,195,538	R76*	probably null	Het
Olfr190	A	T	16: 59,074,192	M296K	probably benign	Het
Olfr228	A	T	2: 86,483,139	I201N	probably damaging	Het
Olfr397	T	C	11: 73,964,808	S67P	probably damaging	Het
Olfr664	G	T	7: 104,733,593	T257K	probably damaging	Het
Olfr872	A	C	9: 20,260,259	I140L	probably damaging	Het
Papolg	A	G	11: 23,867,394	V601A	not run	Het
Pde4dip	T	C	3: 97,758,882	T349A	probably benign	Het
Pdlim5	T	C	3: 142,311,980		probably null	Het
Pkhd1l1	A	G	15: 44,503,280	N718S	probably benign	Het
Plcxd3	A	G	15: 4,516,919	H135R	probably damaging	Het
Plxna2	A	T	1: 194,644,883	Y375F	probably damaging	Het
Prkca	C	T	11: 108,340,645		probably null	Het
Prkdc	A	G	16: 15,717,764	S1663G	probably benign	Het
Ptbp3	T	C	4: 59,514,384	T80A	probably benign	Het
Ptpn4	C	T	1: 119,682,531	V696I	possibly damaging	Het
Pygl	A	T	12: 70,216,568	W175R	possibly damaging	Het
Rftn1	A	G	17: 50,047,441	Y298H	probably damaging	Het
Rit2	A	G	18: 31,316,839		probably null	Het
Runx1t1	G	A	4: 13,846,935	G240R	probably damaging	Het
Scn10a	A	G	9: 119,664,779		probably null	Het
Serpina16	A	C	12: 103,672,432		probably null	Het
Slc17a3	A	T	13: 23,855,848	M290L		Het
Slc6a4	A	T	11: 77,010,696	M86L	probably benign	Het
Spag7	A	T	11: 70,665,313	V46E	probably benign	Het
Sptlc1	T	C	13: 53,344,878	I271V	probably benign	Het
Stk17b	A	C	1: 53,757,515	H364Q	probably benign	Het
Strc	T	C	2: 121,379,452	H130R	probably damaging	Het
Stxbp1	T	A	2: 32,815,014	D148V	probably damaging	Het
Tirap	G	A	9: 35,188,929	P153L	probably damaging	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tmem51	T	A	4: 142,031,783	D218V	probably damaging	Het
Trim40	A	T	17: 36,882,662	D218E	probably benign	Het
Ttc21b	T	C	2: 66,208,718	D934G	probably damaging	Het
Vmn2r26	T	C	6: 124,025,955	L108P	probably damaging	Het
Washc2	C	A	6: 116,227,418	P429Q	probably damaging	Het
Wipi1	A	G	11: 109,611,311	M1T	probably null	Het
Zfp438	A	G	18: 5,214,712	V82A	probably damaging	Het
Zfp853	G	C	5: 143,287,738	A724G	unknown	Het

Other mutations in Bicra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Bicra	APN	7	15996577	missense	possibly damaging	0.70
IGL01521:Bicra	APN	7	15989188	missense	probably benign	0.18
IGL01690:Bicra	APN	7	15987753	missense	probably benign	0.09
IGL01721:Bicra	APN	7	15988699	missense	probably benign
IGL01994:Bicra	APN	7	15972816	missense	possibly damaging	0.46
IGL02084:Bicra	APN	7	15987738	missense	probably benign	0.09
IGL02312:Bicra	APN	7	15993141	missense	possibly damaging	0.85
IGL02686:Bicra	APN	7	15987915	missense	probably benign	0.02
IGL02727:Bicra	APN	7	15979465	missense	possibly damaging	0.95
IGL03031:Bicra	APN	7	15975801	missense	probably benign	0.16
R0003:Bicra	UTSW	7	15971887	missense	probably benign
R0025:Bicra	UTSW	7	15987511	missense	possibly damaging	0.53
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0417:Bicra	UTSW	7	15972322	missense	probably damaging	1.00
R0437:Bicra	UTSW	7	15988762	missense	possibly damaging	0.73
R0547:Bicra	UTSW	7	15972248	missense	probably damaging	1.00
R0688:Bicra	UTSW	7	15989322	missense	probably damaging	1.00
R0855:Bicra	UTSW	7	15972004	missense	probably damaging	1.00
R1448:Bicra	UTSW	7	15988359	missense	possibly damaging	0.86
R1637:Bicra	UTSW	7	15972689	missense	probably benign	0.19
R1899:Bicra	UTSW	7	15987751	missense	possibly damaging	0.53
R2035:Bicra	UTSW	7	15996413	missense	possibly damaging	0.53
R2247:Bicra	UTSW	7	15989234	missense	probably benign	0.33
R2471:Bicra	UTSW	7	15972332	missense	probably benign	0.04
R2484:Bicra	UTSW	7	15988680	missense	possibly damaging	0.96
R3437:Bicra	UTSW	7	15989298	missense	possibly damaging	0.85
R3551:Bicra	UTSW	7	15979733	missense	probably benign	0.33
R4816:Bicra	UTSW	7	15988906	missense	possibly damaging	0.53
R4901:Bicra	UTSW	7	15987601	missense	possibly damaging	0.53
R5035:Bicra	UTSW	7	15979424	missense	possibly damaging	0.90
R5078:Bicra	UTSW	7	15975457	missense	probably damaging	1.00
R5094:Bicra	UTSW	7	15975371	missense	probably damaging	1.00
R5195:Bicra	UTSW	7	15979953	missense	possibly damaging	0.93
R5496:Bicra	UTSW	7	15987841	missense	probably benign	0.33
R5780:Bicra	UTSW	7	15979754	missense	possibly damaging	0.96
R6541:Bicra	UTSW	7	15979129	missense	probably benign	0.00
R6560:Bicra	UTSW	7	15989194	missense	possibly damaging	0.53
R6575:Bicra	UTSW	7	15979131	missense	probably benign	0.25
R6854:Bicra	UTSW	7	15988762	missense	probably benign	0.18
R6967:Bicra	UTSW	7	15972205	missense	probably damaging	0.97
R7454:Bicra	UTSW	7	15972134	missense	probably benign	0.30
R7462:Bicra	UTSW	7	15979135	missense	possibly damaging	0.84
R7488:Bicra	UTSW	7	15989442	critical splice acceptor site	probably null
R7506:Bicra	UTSW	7	15988213	missense	possibly damaging	0.96
R7534:Bicra	UTSW	7	15971935	missense	probably damaging	0.98
R7915:Bicra	UTSW	7	15988522	missense	probably benign
R8063:Bicra	UTSW	7	15979044	missense	probably benign
R8147:Bicra	UTSW	7	15988470	missense	possibly damaging	0.93
R8699:Bicra	UTSW	7	15989188	missense	probably benign	0.18
R8784:Bicra	UTSW	7	15971950	missense	probably damaging	1.00
R8859:Bicra	UTSW	7	15987812	missense	possibly damaging	0.73
R8971:Bicra	UTSW	7	15987556	missense	probably benign	0.08
R9487:Bicra	UTSW	7	15971792	missense	probably damaging	0.99
R9614:Bicra	UTSW	7	15971955	missense	probably damaging	1.00
R9721:Bicra	UTSW	7	15979176	missense	probably damaging	1.00
R9777:Bicra	UTSW	7	15972062	missense	probably benign	0.09
X0064:Bicra	UTSW	7	15975775	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCCATGTTTTCTCGGTAG -3'
(R):5'- TGCCCACCAAGCTAGTGATC -3'

Sequencing Primer
(F):5'- AGGTCTTGCGTAGTGGTAGAC -3'
(R):5'- CAAGCTAGTGATCCGGCAC -3'

Posted On

2019-06-26