Incidental Mutation 'R7283:Spata31h1'
ID 565807
Institutional Source Beutler Lab
Gene Symbol Spata31h1
Ensembl Gene ENSMUSG00000044581
Gene Name SPATA31 subfamily H member 1
Synonyms 4932415D10Rik
MMRRC Submission 045361-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R7283 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 82117950-82152416 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 82127131 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1960 (R1960W)
Ref Sequence ENSEMBL: ENSMUSP00000151425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000217661]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000217661
AA Change: R1960W

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,700,504 (GRCm39) V278A probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abce1 C A 8: 80,411,885 (GRCm39) G592* probably null Het
Acad10 A C 5: 121,787,538 (GRCm39) V137G possibly damaging Het
Adcy3 A G 12: 4,253,563 (GRCm39) I672V not run Het
Adgrb1 A T 15: 74,452,512 (GRCm39) Q1166L possibly damaging Het
Ankrd44 A T 1: 54,768,955 (GRCm39) N465K probably damaging Het
Avpr1b A G 1: 131,537,469 (GRCm39) T418A probably benign Het
Azin1 G A 15: 38,501,652 (GRCm39) T33I probably damaging Het
Bicra T C 7: 15,706,425 (GRCm39) T1339A probably damaging Het
Bltp2 A G 11: 78,165,654 (GRCm39) Q1346R probably damaging Het
Cacna1s A G 1: 136,001,446 (GRCm39) Y299C probably damaging Het
Clip1 A C 5: 123,751,857 (GRCm39) C641W Het
Clip3 T C 7: 30,005,237 (GRCm39) S524P probably damaging Het
Cnpy4 A T 5: 138,191,144 (GRCm39) H240L probably benign Het
Cyp2b19 T C 7: 26,466,339 (GRCm39) Y381H probably damaging Het
Cyp3a13 T A 5: 137,903,818 (GRCm39) N280I probably benign Het
Diaph3 A G 14: 87,104,020 (GRCm39) F788S probably damaging Het
Drc7 A G 8: 95,798,207 (GRCm39) N484S probably damaging Het
Erap1 G A 13: 74,821,903 (GRCm39) probably null Het
Fat4 A T 3: 38,943,842 (GRCm39) I912F probably damaging Het
Hsd3b3 T A 3: 98,649,673 (GRCm39) K217* probably null Het
Igkv12-89 A G 6: 68,812,061 (GRCm39) V36A probably damaging Het
Invs T A 4: 48,392,526 (GRCm39) probably null Het
Ipo8 T A 6: 148,725,979 (GRCm39) Y30F possibly damaging Het
Kctd14 T C 7: 97,100,693 (GRCm39) M1T probably null Het
Klrb1c A T 6: 128,761,220 (GRCm39) C136S probably benign Het
Morn2 A G 17: 80,604,688 (GRCm39) E48G probably damaging Het
Myh1 A T 11: 67,092,670 (GRCm39) probably null Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nfxl1 A G 5: 72,686,393 (GRCm39) S603P probably benign Het
Nlrc3 G A 16: 3,765,741 (GRCm39) A351V probably benign Het
Nlrp4f G A 13: 65,343,352 (GRCm39) R76* probably null Het
Or1e1f T C 11: 73,855,634 (GRCm39) S67P probably damaging Het
Or52n1 G T 7: 104,382,800 (GRCm39) T257K probably damaging Het
Or5h22 A T 16: 58,894,555 (GRCm39) M296K probably benign Het
Or7e176 A C 9: 20,171,555 (GRCm39) I140L probably damaging Het
Or8k41 A T 2: 86,313,483 (GRCm39) I201N probably damaging Het
Papolg A G 11: 23,817,394 (GRCm39) V601A not run Het
Pde4dip T C 3: 97,666,198 (GRCm39) T349A probably benign Het
Pdlim5 T C 3: 142,017,741 (GRCm39) probably null Het
Pkhd1l1 A G 15: 44,366,676 (GRCm39) N718S probably benign Het
Plcxd3 A G 15: 4,546,401 (GRCm39) H135R probably damaging Het
Plxna2 A T 1: 194,327,191 (GRCm39) Y375F probably damaging Het
Prkca C T 11: 108,231,471 (GRCm39) probably null Het
Prkdc A G 16: 15,535,628 (GRCm39) S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 (GRCm39) T80A probably benign Het
Ptpn4 C T 1: 119,610,261 (GRCm39) V696I possibly damaging Het
Pygl A T 12: 70,263,342 (GRCm39) W175R possibly damaging Het
Rftn1 A G 17: 50,354,469 (GRCm39) Y298H probably damaging Het
Rit2 A G 18: 31,449,892 (GRCm39) probably null Het
Runx1t1 G A 4: 13,846,935 (GRCm39) G240R probably damaging Het
Scn10a A G 9: 119,493,845 (GRCm39) probably null Het
Serpina16 A C 12: 103,638,691 (GRCm39) probably null Het
Slc17a3 A T 13: 24,039,831 (GRCm39) M290L Het
Slc6a4 A T 11: 76,901,522 (GRCm39) M86L probably benign Het
Spag7 A T 11: 70,556,139 (GRCm39) V46E probably benign Het
Sptlc1 T C 13: 53,498,914 (GRCm39) I271V probably benign Het
Stk17b A C 1: 53,796,674 (GRCm39) H364Q probably benign Het
Strc T C 2: 121,209,933 (GRCm39) H130R probably damaging Het
Stxbp1 T A 2: 32,705,026 (GRCm39) D148V probably damaging Het
Tirap G A 9: 35,100,225 (GRCm39) P153L probably damaging Het
Tmco3 G A 8: 13,369,605 (GRCm39) probably null Het
Tmem51 T A 4: 141,759,094 (GRCm39) D218V probably damaging Het
Trim40 A T 17: 37,193,554 (GRCm39) D218E probably benign Het
Ttc21b T C 2: 66,039,062 (GRCm39) D934G probably damaging Het
Vmn2r26 T C 6: 124,002,914 (GRCm39) L108P probably damaging Het
Washc2 C A 6: 116,204,379 (GRCm39) P429Q probably damaging Het
Wipi1 A G 11: 109,502,137 (GRCm39) M1T probably null Het
Zfp438 A G 18: 5,214,712 (GRCm39) V82A probably damaging Het
Zfp853 G C 5: 143,273,493 (GRCm39) A724G unknown Het
Other mutations in Spata31h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Spata31h1 APN 10 82,119,586 (GRCm39) missense probably benign 0.06
IGL01457:Spata31h1 APN 10 82,120,568 (GRCm39) missense probably damaging 1.00
IGL01540:Spata31h1 APN 10 82,120,016 (GRCm39) missense possibly damaging 0.87
IGL02693:Spata31h1 APN 10 82,121,092 (GRCm39) missense probably benign 0.06
IGL02867:Spata31h1 APN 10 82,119,654 (GRCm39) missense probably damaging 0.96
IGL02889:Spata31h1 APN 10 82,119,654 (GRCm39) missense probably damaging 0.96
IGL03080:Spata31h1 APN 10 82,119,816 (GRCm39) missense probably damaging 0.99
IGL03120:Spata31h1 APN 10 82,120,869 (GRCm39) missense possibly damaging 0.90
IGL03351:Spata31h1 APN 10 82,119,401 (GRCm39) utr 3 prime probably benign
FR4449:Spata31h1 UTSW 10 82,121,303 (GRCm39) frame shift probably null
FR4548:Spata31h1 UTSW 10 82,126,830 (GRCm39) small insertion probably benign
FR4737:Spata31h1 UTSW 10 82,121,303 (GRCm39) small deletion probably benign
PIT4480001:Spata31h1 UTSW 10 82,119,586 (GRCm39) missense probably benign 0.06
R0102:Spata31h1 UTSW 10 82,119,390 (GRCm39) missense probably damaging 1.00
R0312:Spata31h1 UTSW 10 82,120,203 (GRCm39) missense probably damaging 1.00
R1303:Spata31h1 UTSW 10 82,120,390 (GRCm39) missense possibly damaging 0.94
R2039:Spata31h1 UTSW 10 82,120,510 (GRCm39) missense probably damaging 1.00
R2356:Spata31h1 UTSW 10 82,119,789 (GRCm39) missense possibly damaging 0.94
R4740:Spata31h1 UTSW 10 82,119,481 (GRCm39) missense possibly damaging 0.50
R4857:Spata31h1 UTSW 10 82,119,682 (GRCm39) missense possibly damaging 0.61
R5017:Spata31h1 UTSW 10 82,132,510 (GRCm39) missense unknown
R5095:Spata31h1 UTSW 10 82,119,501 (GRCm39) missense probably damaging 1.00
R5209:Spata31h1 UTSW 10 82,119,652 (GRCm39) missense possibly damaging 0.84
R5388:Spata31h1 UTSW 10 82,119,561 (GRCm39) missense probably damaging 0.99
R5642:Spata31h1 UTSW 10 82,120,317 (GRCm39) missense probably damaging 1.00
R5646:Spata31h1 UTSW 10 82,119,610 (GRCm39) missense probably damaging 0.99
R6188:Spata31h1 UTSW 10 82,121,091 (GRCm39) missense probably damaging 0.96
R6215:Spata31h1 UTSW 10 82,126,946 (GRCm39) missense probably benign 0.07
R6252:Spata31h1 UTSW 10 82,119,588 (GRCm39) missense probably benign 0.30
R6275:Spata31h1 UTSW 10 82,121,202 (GRCm39) missense probably damaging 1.00
R6303:Spata31h1 UTSW 10 82,126,202 (GRCm39) missense possibly damaging 0.79
R6304:Spata31h1 UTSW 10 82,126,202 (GRCm39) missense possibly damaging 0.79
R6313:Spata31h1 UTSW 10 82,129,470 (GRCm39) missense probably benign 0.00
R6323:Spata31h1 UTSW 10 82,118,916 (GRCm39) missense probably benign 0.27
R6374:Spata31h1 UTSW 10 82,124,731 (GRCm39) unclassified probably benign
R6407:Spata31h1 UTSW 10 82,129,645 (GRCm39) missense probably benign 0.16
R6468:Spata31h1 UTSW 10 82,131,150 (GRCm39) missense probably benign 0.01
R6490:Spata31h1 UTSW 10 82,125,138 (GRCm39) missense possibly damaging 0.90
R6605:Spata31h1 UTSW 10 82,131,871 (GRCm39) missense probably benign 0.27
R6614:Spata31h1 UTSW 10 82,127,482 (GRCm39) missense probably benign 0.31
R6626:Spata31h1 UTSW 10 82,128,667 (GRCm39) missense probably benign 0.03
R6630:Spata31h1 UTSW 10 82,122,906 (GRCm39) missense possibly damaging 0.81
R6646:Spata31h1 UTSW 10 82,132,664 (GRCm39) missense unknown
R6723:Spata31h1 UTSW 10 82,125,657 (GRCm39) missense possibly damaging 0.50
R6751:Spata31h1 UTSW 10 82,119,331 (GRCm39) missense probably benign 0.06
R6850:Spata31h1 UTSW 10 82,128,888 (GRCm39) missense possibly damaging 0.68
R6944:Spata31h1 UTSW 10 82,132,056 (GRCm39) missense probably benign 0.03
R6957:Spata31h1 UTSW 10 82,129,620 (GRCm39) missense probably benign 0.03
R6988:Spata31h1 UTSW 10 82,127,733 (GRCm39) missense possibly damaging 0.79
R7069:Spata31h1 UTSW 10 82,125,777 (GRCm39) missense probably damaging 0.99
R7164:Spata31h1 UTSW 10 82,122,063 (GRCm39) missense probably damaging 1.00
R7175:Spata31h1 UTSW 10 82,122,583 (GRCm39) missense probably damaging 1.00
R7201:Spata31h1 UTSW 10 82,127,461 (GRCm39) missense probably benign 0.03
R7203:Spata31h1 UTSW 10 82,129,248 (GRCm39) missense probably benign 0.00
R7205:Spata31h1 UTSW 10 82,125,161 (GRCm39) missense probably benign 0.35
R7241:Spata31h1 UTSW 10 82,122,876 (GRCm39) missense probably benign 0.01
R7305:Spata31h1 UTSW 10 82,120,953 (GRCm39) missense probably benign 0.06
R7358:Spata31h1 UTSW 10 82,127,847 (GRCm39) missense possibly damaging 0.79
R7360:Spata31h1 UTSW 10 82,132,341 (GRCm39) missense unknown
R7362:Spata31h1 UTSW 10 82,128,831 (GRCm39) missense possibly damaging 0.79
R7385:Spata31h1 UTSW 10 82,123,729 (GRCm39) missense probably benign 0.05
R7385:Spata31h1 UTSW 10 82,123,571 (GRCm39) missense probably benign 0.03
R7472:Spata31h1 UTSW 10 82,119,421 (GRCm39) missense probably benign 0.03
R7493:Spata31h1 UTSW 10 82,152,264 (GRCm39) missense unknown
R7493:Spata31h1 UTSW 10 82,124,798 (GRCm39) nonsense probably null
R7498:Spata31h1 UTSW 10 82,127,113 (GRCm39) missense probably benign 0.03
R7512:Spata31h1 UTSW 10 82,128,469 (GRCm39) missense probably benign 0.31
R7560:Spata31h1 UTSW 10 82,120,449 (GRCm39) missense probably damaging 1.00
R7591:Spata31h1 UTSW 10 82,128,046 (GRCm39) missense probably benign 0.16
R7636:Spata31h1 UTSW 10 82,130,973 (GRCm39) missense probably benign 0.01
R7640:Spata31h1 UTSW 10 82,130,490 (GRCm39) missense probably damaging 0.99
R7709:Spata31h1 UTSW 10 82,126,366 (GRCm39) missense possibly damaging 0.81
R7790:Spata31h1 UTSW 10 82,123,329 (GRCm39) missense probably benign 0.06
R7875:Spata31h1 UTSW 10 82,123,456 (GRCm39) missense possibly damaging 0.79
R7878:Spata31h1 UTSW 10 82,119,856 (GRCm39) missense probably benign 0.04
R7899:Spata31h1 UTSW 10 82,118,731 (GRCm39) missense unknown
R7905:Spata31h1 UTSW 10 82,131,936 (GRCm39) missense probably benign 0.03
R7975:Spata31h1 UTSW 10 82,119,823 (GRCm39) missense possibly damaging 0.95
R7988:Spata31h1 UTSW 10 82,131,934 (GRCm39) missense probably benign 0.03
R8076:Spata31h1 UTSW 10 82,132,520 (GRCm39) nonsense probably null
R8144:Spata31h1 UTSW 10 82,130,433 (GRCm39) nonsense probably null
R8429:Spata31h1 UTSW 10 82,125,301 (GRCm39) missense possibly damaging 0.62
R8465:Spata31h1 UTSW 10 82,152,298 (GRCm39) missense possibly damaging 0.52
R8470:Spata31h1 UTSW 10 82,126,314 (GRCm39) missense probably damaging 1.00
R8509:Spata31h1 UTSW 10 82,126,950 (GRCm39) missense probably benign 0.01
R8515:Spata31h1 UTSW 10 82,124,436 (GRCm39) missense probably benign 0.00
R8672:Spata31h1 UTSW 10 82,127,726 (GRCm39) missense probably benign 0.01
R8700:Spata31h1 UTSW 10 82,127,859 (GRCm39) missense possibly damaging 0.84
R8827:Spata31h1 UTSW 10 82,129,617 (GRCm39) missense probably benign 0.07
R8872:Spata31h1 UTSW 10 82,128,619 (GRCm39) missense probably benign 0.07
R8875:Spata31h1 UTSW 10 82,123,476 (GRCm39) missense probably benign 0.16
R8884:Spata31h1 UTSW 10 82,119,486 (GRCm39) missense probably damaging 0.96
R8906:Spata31h1 UTSW 10 82,122,379 (GRCm39) missense probably benign 0.02
R8924:Spata31h1 UTSW 10 82,131,295 (GRCm39) missense probably benign 0.03
R8949:Spata31h1 UTSW 10 82,123,753 (GRCm39) missense probably benign 0.00
R8957:Spata31h1 UTSW 10 82,124,908 (GRCm39) missense probably benign 0.07
R9042:Spata31h1 UTSW 10 82,123,185 (GRCm39) missense probably benign 0.08
R9056:Spata31h1 UTSW 10 82,127,101 (GRCm39) missense probably benign 0.01
R9062:Spata31h1 UTSW 10 82,126,945 (GRCm39) missense probably benign 0.03
R9074:Spata31h1 UTSW 10 82,123,894 (GRCm39) missense possibly damaging 0.90
R9086:Spata31h1 UTSW 10 82,124,577 (GRCm39) missense probably benign 0.07
R9113:Spata31h1 UTSW 10 82,131,352 (GRCm39) nonsense probably null
R9119:Spata31h1 UTSW 10 82,131,553 (GRCm39) missense probably benign 0.03
R9132:Spata31h1 UTSW 10 82,127,896 (GRCm39) missense possibly damaging 0.85
R9141:Spata31h1 UTSW 10 82,126,610 (GRCm39) missense probably damaging 0.98
R9151:Spata31h1 UTSW 10 82,120,928 (GRCm39) missense probably damaging 0.99
R9155:Spata31h1 UTSW 10 82,120,203 (GRCm39) missense probably damaging 1.00
R9159:Spata31h1 UTSW 10 82,118,524 (GRCm39) nonsense probably null
R9197:Spata31h1 UTSW 10 82,120,401 (GRCm39) missense possibly damaging 0.88
R9212:Spata31h1 UTSW 10 82,118,979 (GRCm39) missense possibly damaging 0.88
R9245:Spata31h1 UTSW 10 82,123,554 (GRCm39) missense probably benign 0.10
R9304:Spata31h1 UTSW 10 82,131,930 (GRCm39) missense probably benign 0.07
R9309:Spata31h1 UTSW 10 82,130,986 (GRCm39) missense probably benign 0.00
R9329:Spata31h1 UTSW 10 82,121,439 (GRCm39) missense probably benign 0.06
R9356:Spata31h1 UTSW 10 82,125,157 (GRCm39) missense possibly damaging 0.54
R9423:Spata31h1 UTSW 10 82,123,459 (GRCm39) missense possibly damaging 0.62
R9426:Spata31h1 UTSW 10 82,126,610 (GRCm39) missense probably damaging 0.98
R9457:Spata31h1 UTSW 10 82,122,573 (GRCm39) missense probably benign 0.02
R9509:Spata31h1 UTSW 10 82,132,229 (GRCm39) missense probably benign 0.03
R9612:Spata31h1 UTSW 10 82,125,453 (GRCm39) missense possibly damaging 0.55
R9674:Spata31h1 UTSW 10 82,120,030 (GRCm39) missense possibly damaging 0.69
R9726:Spata31h1 UTSW 10 82,118,605 (GRCm39) missense unknown
RF017:Spata31h1 UTSW 10 82,126,826 (GRCm39) small insertion probably benign
RF055:Spata31h1 UTSW 10 82,126,827 (GRCm39) small insertion probably benign
Z1176:Spata31h1 UTSW 10 82,129,062 (GRCm39) missense probably benign 0.03
Z1176:Spata31h1 UTSW 10 82,125,730 (GRCm39) missense possibly damaging 0.94
Z1176:Spata31h1 UTSW 10 82,118,371 (GRCm39) missense unknown
Z1177:Spata31h1 UTSW 10 82,123,251 (GRCm39) missense probably damaging 0.99
Z1177:Spata31h1 UTSW 10 82,122,960 (GRCm39) missense possibly damaging 0.85
Z1177:Spata31h1 UTSW 10 82,121,632 (GRCm39) missense possibly damaging 0.46
Z1177:Spata31h1 UTSW 10 82,125,520 (GRCm39) nonsense probably null
Z1187:Spata31h1 UTSW 10 82,124,390 (GRCm39) small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGACGCCTTGAAATGGTGACC -3'
(R):5'- TGTGGCACTAATTACAGAACCC -3'

Sequencing Primer
(F):5'- GCCTTGAAATGGTGACCAACTTTTG -3'
(R):5'- GCACAAAGTCTATTCAATGGATACC -3'
Posted On 2019-06-26