Incidental Mutation 'R7283:2610507B11Rik'
ID565813
Institutional Source Beutler Lab
Gene Symbol 2610507B11Rik
Ensembl Gene ENSMUSG00000010277
Gene NameRIKEN cDNA 2610507B11 gene
SynonymsD11Bhm178e, D11Bhm179e, E1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R7283 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78261752-78290623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78274828 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1346 (Q1346R)
Ref Sequence ENSEMBL: ENSMUSP00000010421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010421]
Predicted Effect probably damaging
Transcript: ENSMUST00000010421
AA Change: Q1346R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010421
Gene: ENSMUSG00000010277
AA Change: Q1346R

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:Fmp27 26 475 1.6e-45 PFAM
Pfam:Fmp27 446 674 3.2e-24 PFAM
low complexity region 719 734 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Fmp27_GFWDK 1028 1160 3.01e-61 SMART
low complexity region 1415 1421 N/A INTRINSIC
low complexity region 1690 1701 N/A INTRINSIC
Pfam:Apt1 1703 2176 2.4e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145145
SMART Domains Protein: ENSMUSP00000119105
Gene: ENSMUSG00000010277

DomainStartEndE-ValueType
Pfam:Fmp27_GFWDK 1 52 1.2e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,552,691 V278A probably benign Het
4932415D10Rik G A 10: 82,291,297 R1960W possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abce1 C A 8: 79,685,256 G592* probably null Het
Acad10 A C 5: 121,649,475 V137G possibly damaging Het
Adcy3 A G 12: 4,203,563 I672V not run Het
Adgrb1 A T 15: 74,580,663 Q1166L possibly damaging Het
Ankrd44 A T 1: 54,729,796 N465K probably damaging Het
Avpr1b A G 1: 131,609,731 T418A probably benign Het
Azin1 G A 15: 38,501,408 T33I probably damaging Het
Bicra T C 7: 15,972,500 T1339A probably damaging Het
C2cd4c A G 10: 79,612,572 V247A possibly damaging Het
Cacna1s A G 1: 136,073,708 Y299C probably damaging Het
Clip1 A C 5: 123,613,794 C641W Het
Clip3 T C 7: 30,305,812 S524P probably damaging Het
Cnpy4 A T 5: 138,192,882 H240L probably benign Het
Cyp2b19 T C 7: 26,766,914 Y381H probably damaging Het
Cyp3a13 T A 5: 137,905,556 N280I probably benign Het
Diaph3 A G 14: 86,866,584 F788S probably damaging Het
Drc7 A G 8: 95,071,579 N484S probably damaging Het
Erap1 G A 13: 74,673,784 probably null Het
Fat4 A T 3: 38,889,693 I912F probably damaging Het
Hsd3b3 T A 3: 98,742,357 K217* probably null Het
Igkv12-89 A G 6: 68,835,077 V36A probably damaging Het
Invs T A 4: 48,392,526 probably null Het
Ipo8 T A 6: 148,824,481 Y30F possibly damaging Het
Kctd14 T C 7: 97,451,486 M1T probably null Het
Klrb1c A T 6: 128,784,257 C136S probably benign Het
Morn2 A G 17: 80,297,259 E48G probably damaging Het
Myh1 A T 11: 67,201,844 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfxl1 A G 5: 72,529,050 S603P probably benign Het
Nlrc3 G A 16: 3,947,877 A351V probably benign Het
Nlrp4f G A 13: 65,195,538 R76* probably null Het
Olfr190 A T 16: 59,074,192 M296K probably benign Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr397 T C 11: 73,964,808 S67P probably damaging Het
Olfr664 G T 7: 104,733,593 T257K probably damaging Het
Olfr872 A C 9: 20,260,259 I140L probably damaging Het
Papolg A G 11: 23,867,394 V601A not run Het
Pde4dip T C 3: 97,758,882 T349A probably benign Het
Pdlim5 T C 3: 142,311,980 probably null Het
Pkhd1l1 A G 15: 44,503,280 N718S probably benign Het
Plcxd3 A G 15: 4,516,919 H135R probably damaging Het
Plxna2 A T 1: 194,644,883 Y375F probably damaging Het
Prkca C T 11: 108,340,645 probably null Het
Prkdc A G 16: 15,717,764 S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 T80A probably benign Het
Ptpn4 C T 1: 119,682,531 V696I possibly damaging Het
Pygl A T 12: 70,216,568 W175R possibly damaging Het
Rftn1 A G 17: 50,047,441 Y298H probably damaging Het
Rit2 A G 18: 31,316,839 probably null Het
Runx1t1 G A 4: 13,846,935 G240R probably damaging Het
Scn10a A G 9: 119,664,779 probably null Het
Serpina16 A C 12: 103,672,432 probably null Het
Slc17a3 A T 13: 23,855,848 M290L Het
Slc6a4 A T 11: 77,010,696 M86L probably benign Het
Spag7 A T 11: 70,665,313 V46E probably benign Het
Sptlc1 T C 13: 53,344,878 I271V probably benign Het
Stk17b A C 1: 53,757,515 H364Q probably benign Het
Strc T C 2: 121,379,452 H130R probably damaging Het
Stxbp1 T A 2: 32,815,014 D148V probably damaging Het
Tirap G A 9: 35,188,929 P153L probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem51 T A 4: 142,031,783 D218V probably damaging Het
Trim40 A T 17: 36,882,662 D218E probably benign Het
Ttc21b T C 2: 66,208,718 D934G probably damaging Het
Vmn2r26 T C 6: 124,025,955 L108P probably damaging Het
Washc2 C A 6: 116,227,418 P429Q probably damaging Het
Wipi1 A G 11: 109,611,311 M1T probably null Het
Zfp438 A G 18: 5,214,712 V82A probably damaging Het
Zfp853 G C 5: 143,287,738 A724G unknown Het
Other mutations in 2610507B11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:2610507B11Rik APN 11 78269574 missense possibly damaging 0.55
IGL00497:2610507B11Rik APN 11 78272933 missense probably damaging 1.00
IGL00797:2610507B11Rik APN 11 78273150 missense probably benign 0.07
IGL01695:2610507B11Rik APN 11 78265193 missense probably benign 0.03
IGL02055:2610507B11Rik APN 11 78286631 missense probably damaging 1.00
IGL02066:2610507B11Rik APN 11 78273232 missense probably damaging 1.00
IGL02231:2610507B11Rik APN 11 78279896 missense probably benign
IGL02282:2610507B11Rik APN 11 78284228 missense probably benign 0.22
IGL02293:2610507B11Rik APN 11 78271910 missense probably damaging 1.00
IGL02336:2610507B11Rik APN 11 78289032 missense probably damaging 1.00
IGL02528:2610507B11Rik APN 11 78271976 missense possibly damaging 0.93
IGL03231:2610507B11Rik APN 11 78268702 missense probably benign 0.02
R0003:2610507B11Rik UTSW 11 78286578 missense possibly damaging 0.66
R0197:2610507B11Rik UTSW 11 78269704 unclassified probably benign
R0244:2610507B11Rik UTSW 11 78286491 unclassified probably null
R0281:2610507B11Rik UTSW 11 78271924 missense possibly damaging 0.88
R0396:2610507B11Rik UTSW 11 78268377 missense possibly damaging 0.93
R0624:2610507B11Rik UTSW 11 78268457 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78287987 missense probably damaging 1.00
R0666:2610507B11Rik UTSW 11 78277212 nonsense probably null
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1313:2610507B11Rik UTSW 11 78265672 missense probably benign 0.02
R1443:2610507B11Rik UTSW 11 78262798 missense probably damaging 1.00
R1485:2610507B11Rik UTSW 11 78285580 missense probably damaging 1.00
R1500:2610507B11Rik UTSW 11 78284132 missense possibly damaging 0.46
R1537:2610507B11Rik UTSW 11 78289343 missense probably damaging 1.00
R1543:2610507B11Rik UTSW 11 78275174 missense probably benign 0.44
R1702:2610507B11Rik UTSW 11 78289028 missense probably damaging 1.00
R1804:2610507B11Rik UTSW 11 78273469 missense probably damaging 1.00
R1835:2610507B11Rik UTSW 11 78287750 missense probably damaging 0.97
R1852:2610507B11Rik UTSW 11 78268473 missense probably damaging 1.00
R1861:2610507B11Rik UTSW 11 78287929 unclassified probably benign
R1986:2610507B11Rik UTSW 11 78274612 missense probably damaging 1.00
R1987:2610507B11Rik UTSW 11 78268167 missense probably damaging 1.00
R2061:2610507B11Rik UTSW 11 78268749 nonsense probably null
R2113:2610507B11Rik UTSW 11 78268772 missense probably benign 0.02
R3692:2610507B11Rik UTSW 11 78269509 missense probably damaging 1.00
R3788:2610507B11Rik UTSW 11 78288297 critical splice donor site probably null
R3835:2610507B11Rik UTSW 11 78279085 missense probably benign 0.17
R3882:2610507B11Rik UTSW 11 78262700 missense probably damaging 1.00
R3943:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3944:2610507B11Rik UTSW 11 78269524 nonsense probably null
R3945:2610507B11Rik UTSW 11 78289964 missense probably damaging 1.00
R4196:2610507B11Rik UTSW 11 78263556 intron probably benign
R4510:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4511:2610507B11Rik UTSW 11 78277328 missense possibly damaging 0.59
R4756:2610507B11Rik UTSW 11 78264028 missense probably damaging 0.98
R5337:2610507B11Rik UTSW 11 78265208 missense possibly damaging 0.46
R5419:2610507B11Rik UTSW 11 78272090 nonsense probably null
R5572:2610507B11Rik UTSW 11 78264567 missense probably damaging 0.98
R5719:2610507B11Rik UTSW 11 78273245 missense probably damaging 0.97
R5754:2610507B11Rik UTSW 11 78269541 missense probably damaging 1.00
R5890:2610507B11Rik UTSW 11 78273270 nonsense probably null
R5919:2610507B11Rik UTSW 11 78289350 missense probably damaging 1.00
R5925:2610507B11Rik UTSW 11 78284238 missense probably benign 0.06
R5976:2610507B11Rik UTSW 11 78284129 missense probably benign 0.00
R5999:2610507B11Rik UTSW 11 78285468 missense probably damaging 1.00
R6056:2610507B11Rik UTSW 11 78271384 missense possibly damaging 0.77
R6180:2610507B11Rik UTSW 11 78273258 missense possibly damaging 0.51
R6484:2610507B11Rik UTSW 11 78279095 missense probably damaging 1.00
R6721:2610507B11Rik UTSW 11 78279799 missense probably damaging 1.00
R6800:2610507B11Rik UTSW 11 78288279 missense probably benign 0.13
R6911:2610507B11Rik UTSW 11 78268353 missense probably damaging 0.99
R6923:2610507B11Rik UTSW 11 78274626 missense possibly damaging 0.67
R7287:2610507B11Rik UTSW 11 78272883 missense possibly damaging 0.61
R7339:2610507B11Rik UTSW 11 78272384 critical splice donor site probably null
R7409:2610507B11Rik UTSW 11 78268757 missense probably damaging 1.00
R7473:2610507B11Rik UTSW 11 78267115 missense possibly damaging 0.86
R7704:2610507B11Rik UTSW 11 78268744 missense probably benign 0.29
X0028:2610507B11Rik UTSW 11 78286635 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCCAGCTACAGGTTAGACTC -3'
(R):5'- TCCACTCAGAAATAAGGCGC -3'

Sequencing Primer
(F):5'- GCTACAGGTTAGACTCAGCATC -3'
(R):5'- ATAAGGCGCCGCATCACTG -3'
Posted On2019-06-26