Incidental Mutation 'R7283:Bltp2'
ID 565813
Institutional Source Beutler Lab
Gene Symbol Bltp2
Ensembl Gene ENSMUSG00000010277
Gene Name bridge-like lipid transfer protein family member 2
Synonyms 2610507B11Rik
MMRRC Submission 045361-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R7283 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 78152578-78181449 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 78165654 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 1346 (Q1346R)
Ref Sequence ENSEMBL: ENSMUSP00000010421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010421]
AlphaFold Q5SYL3
Predicted Effect probably damaging
Transcript: ENSMUST00000010421
AA Change: Q1346R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010421
Gene: ENSMUSG00000010277
AA Change: Q1346R

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:Fmp27 26 475 1.6e-45 PFAM
Pfam:Fmp27 446 674 3.2e-24 PFAM
low complexity region 719 734 N/A INTRINSIC
low complexity region 785 798 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
Fmp27_GFWDK 1028 1160 3.01e-61 SMART
low complexity region 1415 1421 N/A INTRINSIC
low complexity region 1690 1701 N/A INTRINSIC
Pfam:Apt1 1703 2176 2.4e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145145
SMART Domains Protein: ENSMUSP00000119105
Gene: ENSMUSG00000010277

DomainStartEndE-ValueType
Pfam:Fmp27_GFWDK 1 52 1.2e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,700,504 (GRCm39) V278A probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abce1 C A 8: 80,411,885 (GRCm39) G592* probably null Het
Acad10 A C 5: 121,787,538 (GRCm39) V137G possibly damaging Het
Adcy3 A G 12: 4,253,563 (GRCm39) I672V not run Het
Adgrb1 A T 15: 74,452,512 (GRCm39) Q1166L possibly damaging Het
Ankrd44 A T 1: 54,768,955 (GRCm39) N465K probably damaging Het
Avpr1b A G 1: 131,537,469 (GRCm39) T418A probably benign Het
Azin1 G A 15: 38,501,652 (GRCm39) T33I probably damaging Het
Bicra T C 7: 15,706,425 (GRCm39) T1339A probably damaging Het
Cacna1s A G 1: 136,001,446 (GRCm39) Y299C probably damaging Het
Clip1 A C 5: 123,751,857 (GRCm39) C641W Het
Clip3 T C 7: 30,005,237 (GRCm39) S524P probably damaging Het
Cnpy4 A T 5: 138,191,144 (GRCm39) H240L probably benign Het
Cyp2b19 T C 7: 26,466,339 (GRCm39) Y381H probably damaging Het
Cyp3a13 T A 5: 137,903,818 (GRCm39) N280I probably benign Het
Diaph3 A G 14: 87,104,020 (GRCm39) F788S probably damaging Het
Drc7 A G 8: 95,798,207 (GRCm39) N484S probably damaging Het
Erap1 G A 13: 74,821,903 (GRCm39) probably null Het
Fat4 A T 3: 38,943,842 (GRCm39) I912F probably damaging Het
Hsd3b3 T A 3: 98,649,673 (GRCm39) K217* probably null Het
Igkv12-89 A G 6: 68,812,061 (GRCm39) V36A probably damaging Het
Invs T A 4: 48,392,526 (GRCm39) probably null Het
Ipo8 T A 6: 148,725,979 (GRCm39) Y30F possibly damaging Het
Kctd14 T C 7: 97,100,693 (GRCm39) M1T probably null Het
Klrb1c A T 6: 128,761,220 (GRCm39) C136S probably benign Het
Morn2 A G 17: 80,604,688 (GRCm39) E48G probably damaging Het
Myh1 A T 11: 67,092,670 (GRCm39) probably null Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nfxl1 A G 5: 72,686,393 (GRCm39) S603P probably benign Het
Nlrc3 G A 16: 3,765,741 (GRCm39) A351V probably benign Het
Nlrp4f G A 13: 65,343,352 (GRCm39) R76* probably null Het
Or1e1f T C 11: 73,855,634 (GRCm39) S67P probably damaging Het
Or52n1 G T 7: 104,382,800 (GRCm39) T257K probably damaging Het
Or5h22 A T 16: 58,894,555 (GRCm39) M296K probably benign Het
Or7e176 A C 9: 20,171,555 (GRCm39) I140L probably damaging Het
Or8k41 A T 2: 86,313,483 (GRCm39) I201N probably damaging Het
Papolg A G 11: 23,817,394 (GRCm39) V601A not run Het
Pde4dip T C 3: 97,666,198 (GRCm39) T349A probably benign Het
Pdlim5 T C 3: 142,017,741 (GRCm39) probably null Het
Pkhd1l1 A G 15: 44,366,676 (GRCm39) N718S probably benign Het
Plcxd3 A G 15: 4,546,401 (GRCm39) H135R probably damaging Het
Plxna2 A T 1: 194,327,191 (GRCm39) Y375F probably damaging Het
Prkca C T 11: 108,231,471 (GRCm39) probably null Het
Prkdc A G 16: 15,535,628 (GRCm39) S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 (GRCm39) T80A probably benign Het
Ptpn4 C T 1: 119,610,261 (GRCm39) V696I possibly damaging Het
Pygl A T 12: 70,263,342 (GRCm39) W175R possibly damaging Het
Rftn1 A G 17: 50,354,469 (GRCm39) Y298H probably damaging Het
Rit2 A G 18: 31,449,892 (GRCm39) probably null Het
Runx1t1 G A 4: 13,846,935 (GRCm39) G240R probably damaging Het
Scn10a A G 9: 119,493,845 (GRCm39) probably null Het
Serpina16 A C 12: 103,638,691 (GRCm39) probably null Het
Slc17a3 A T 13: 24,039,831 (GRCm39) M290L Het
Slc6a4 A T 11: 76,901,522 (GRCm39) M86L probably benign Het
Spag7 A T 11: 70,556,139 (GRCm39) V46E probably benign Het
Spata31h1 G A 10: 82,127,131 (GRCm39) R1960W possibly damaging Het
Sptlc1 T C 13: 53,498,914 (GRCm39) I271V probably benign Het
Stk17b A C 1: 53,796,674 (GRCm39) H364Q probably benign Het
Strc T C 2: 121,209,933 (GRCm39) H130R probably damaging Het
Stxbp1 T A 2: 32,705,026 (GRCm39) D148V probably damaging Het
Tirap G A 9: 35,100,225 (GRCm39) P153L probably damaging Het
Tmco3 G A 8: 13,369,605 (GRCm39) probably null Het
Tmem51 T A 4: 141,759,094 (GRCm39) D218V probably damaging Het
Trim40 A T 17: 37,193,554 (GRCm39) D218E probably benign Het
Ttc21b T C 2: 66,039,062 (GRCm39) D934G probably damaging Het
Vmn2r26 T C 6: 124,002,914 (GRCm39) L108P probably damaging Het
Washc2 C A 6: 116,204,379 (GRCm39) P429Q probably damaging Het
Wipi1 A G 11: 109,502,137 (GRCm39) M1T probably null Het
Zfp438 A G 18: 5,214,712 (GRCm39) V82A probably damaging Het
Zfp853 G C 5: 143,273,493 (GRCm39) A724G unknown Het
Other mutations in Bltp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Bltp2 APN 11 78,160,400 (GRCm39) missense possibly damaging 0.55
IGL00497:Bltp2 APN 11 78,163,759 (GRCm39) missense probably damaging 1.00
IGL00797:Bltp2 APN 11 78,163,976 (GRCm39) missense probably benign 0.07
IGL01695:Bltp2 APN 11 78,156,019 (GRCm39) missense probably benign 0.03
IGL02055:Bltp2 APN 11 78,177,457 (GRCm39) missense probably damaging 1.00
IGL02066:Bltp2 APN 11 78,164,058 (GRCm39) missense probably damaging 1.00
IGL02231:Bltp2 APN 11 78,170,722 (GRCm39) missense probably benign
IGL02282:Bltp2 APN 11 78,175,054 (GRCm39) missense probably benign 0.22
IGL02293:Bltp2 APN 11 78,162,736 (GRCm39) missense probably damaging 1.00
IGL02336:Bltp2 APN 11 78,179,858 (GRCm39) missense probably damaging 1.00
IGL02528:Bltp2 APN 11 78,162,802 (GRCm39) missense possibly damaging 0.93
IGL03231:Bltp2 APN 11 78,159,528 (GRCm39) missense probably benign 0.02
R0003:Bltp2 UTSW 11 78,177,404 (GRCm39) missense possibly damaging 0.66
R0197:Bltp2 UTSW 11 78,160,530 (GRCm39) unclassified probably benign
R0244:Bltp2 UTSW 11 78,177,317 (GRCm39) splice site probably null
R0281:Bltp2 UTSW 11 78,162,750 (GRCm39) missense possibly damaging 0.88
R0396:Bltp2 UTSW 11 78,159,203 (GRCm39) missense possibly damaging 0.93
R0624:Bltp2 UTSW 11 78,159,283 (GRCm39) missense probably damaging 1.00
R0666:Bltp2 UTSW 11 78,168,038 (GRCm39) nonsense probably null
R0666:Bltp2 UTSW 11 78,178,813 (GRCm39) missense probably damaging 1.00
R1313:Bltp2 UTSW 11 78,156,498 (GRCm39) missense probably benign 0.02
R1313:Bltp2 UTSW 11 78,156,498 (GRCm39) missense probably benign 0.02
R1443:Bltp2 UTSW 11 78,153,624 (GRCm39) missense probably damaging 1.00
R1485:Bltp2 UTSW 11 78,176,406 (GRCm39) missense probably damaging 1.00
R1500:Bltp2 UTSW 11 78,174,958 (GRCm39) missense possibly damaging 0.46
R1537:Bltp2 UTSW 11 78,180,169 (GRCm39) missense probably damaging 1.00
R1543:Bltp2 UTSW 11 78,166,000 (GRCm39) missense probably benign 0.44
R1702:Bltp2 UTSW 11 78,179,854 (GRCm39) missense probably damaging 1.00
R1804:Bltp2 UTSW 11 78,164,295 (GRCm39) missense probably damaging 1.00
R1835:Bltp2 UTSW 11 78,178,576 (GRCm39) missense probably damaging 0.97
R1852:Bltp2 UTSW 11 78,159,299 (GRCm39) missense probably damaging 1.00
R1861:Bltp2 UTSW 11 78,178,755 (GRCm39) unclassified probably benign
R1986:Bltp2 UTSW 11 78,165,438 (GRCm39) missense probably damaging 1.00
R1987:Bltp2 UTSW 11 78,158,993 (GRCm39) missense probably damaging 1.00
R2061:Bltp2 UTSW 11 78,159,575 (GRCm39) nonsense probably null
R2113:Bltp2 UTSW 11 78,159,598 (GRCm39) missense probably benign 0.02
R3692:Bltp2 UTSW 11 78,160,335 (GRCm39) missense probably damaging 1.00
R3788:Bltp2 UTSW 11 78,179,123 (GRCm39) critical splice donor site probably null
R3835:Bltp2 UTSW 11 78,169,911 (GRCm39) missense probably benign 0.17
R3882:Bltp2 UTSW 11 78,153,526 (GRCm39) missense probably damaging 1.00
R3943:Bltp2 UTSW 11 78,160,350 (GRCm39) nonsense probably null
R3944:Bltp2 UTSW 11 78,160,350 (GRCm39) nonsense probably null
R3945:Bltp2 UTSW 11 78,180,790 (GRCm39) missense probably damaging 1.00
R4196:Bltp2 UTSW 11 78,154,382 (GRCm39) intron probably benign
R4510:Bltp2 UTSW 11 78,168,154 (GRCm39) missense possibly damaging 0.59
R4511:Bltp2 UTSW 11 78,168,154 (GRCm39) missense possibly damaging 0.59
R4756:Bltp2 UTSW 11 78,154,854 (GRCm39) missense probably damaging 0.98
R5337:Bltp2 UTSW 11 78,156,034 (GRCm39) missense possibly damaging 0.46
R5419:Bltp2 UTSW 11 78,162,916 (GRCm39) nonsense probably null
R5572:Bltp2 UTSW 11 78,155,393 (GRCm39) missense probably damaging 0.98
R5719:Bltp2 UTSW 11 78,164,071 (GRCm39) missense probably damaging 0.97
R5754:Bltp2 UTSW 11 78,160,367 (GRCm39) missense probably damaging 1.00
R5890:Bltp2 UTSW 11 78,164,096 (GRCm39) nonsense probably null
R5919:Bltp2 UTSW 11 78,180,176 (GRCm39) missense probably damaging 1.00
R5925:Bltp2 UTSW 11 78,175,064 (GRCm39) missense probably benign 0.06
R5976:Bltp2 UTSW 11 78,174,955 (GRCm39) missense probably benign 0.00
R5999:Bltp2 UTSW 11 78,176,294 (GRCm39) missense probably damaging 1.00
R6056:Bltp2 UTSW 11 78,162,210 (GRCm39) missense possibly damaging 0.77
R6180:Bltp2 UTSW 11 78,164,084 (GRCm39) missense possibly damaging 0.51
R6484:Bltp2 UTSW 11 78,169,921 (GRCm39) missense probably damaging 1.00
R6721:Bltp2 UTSW 11 78,170,625 (GRCm39) missense probably damaging 1.00
R6800:Bltp2 UTSW 11 78,179,105 (GRCm39) missense probably benign 0.13
R6911:Bltp2 UTSW 11 78,159,179 (GRCm39) missense probably damaging 0.99
R6923:Bltp2 UTSW 11 78,165,452 (GRCm39) missense possibly damaging 0.67
R7287:Bltp2 UTSW 11 78,163,709 (GRCm39) missense possibly damaging 0.61
R7339:Bltp2 UTSW 11 78,163,210 (GRCm39) critical splice donor site probably null
R7409:Bltp2 UTSW 11 78,159,583 (GRCm39) missense probably damaging 1.00
R7473:Bltp2 UTSW 11 78,157,941 (GRCm39) missense possibly damaging 0.86
R7704:Bltp2 UTSW 11 78,159,570 (GRCm39) missense probably benign 0.29
R7793:Bltp2 UTSW 11 78,164,031 (GRCm39) missense possibly damaging 0.56
R8051:Bltp2 UTSW 11 78,164,238 (GRCm39) intron probably benign
R8186:Bltp2 UTSW 11 78,177,457 (GRCm39) missense probably damaging 1.00
R8256:Bltp2 UTSW 11 78,167,979 (GRCm39) missense probably benign 0.00
R8518:Bltp2 UTSW 11 78,156,064 (GRCm39) missense possibly damaging 0.95
R8677:Bltp2 UTSW 11 78,174,982 (GRCm39) missense probably damaging 1.00
R8736:Bltp2 UTSW 11 78,178,875 (GRCm39) missense probably benign 0.26
R8829:Bltp2 UTSW 11 78,158,064 (GRCm39) missense probably benign 0.02
R8832:Bltp2 UTSW 11 78,158,064 (GRCm39) missense probably benign 0.02
R9006:Bltp2 UTSW 11 78,164,345 (GRCm39) missense possibly damaging 0.90
R9014:Bltp2 UTSW 11 78,160,488 (GRCm39) missense possibly damaging 0.78
R9184:Bltp2 UTSW 11 78,162,214 (GRCm39) missense probably damaging 1.00
R9473:Bltp2 UTSW 11 78,174,983 (GRCm39) missense probably damaging 1.00
X0028:Bltp2 UTSW 11 78,177,461 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCCAGCTACAGGTTAGACTC -3'
(R):5'- TCCACTCAGAAATAAGGCGC -3'

Sequencing Primer
(F):5'- GCTACAGGTTAGACTCAGCATC -3'
(R):5'- ATAAGGCGCCGCATCACTG -3'
Posted On 2019-06-26