Mutagenetix > Incidental Mutation

Incidental Mutation 'R7283:Pygl'

565818

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.401) question?

Stock #

R7283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70216568 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 175 (W175R)

Ref Sequence

ENSEMBL: ENSMUSP00000071231 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071250
AA Change: W175R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069
AA Change: W175R

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161083
AA Change: W84R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069
AA Change: W84R

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,274,828	Q1346R	probably damaging	Het
4833439L19Rik	A	G	13: 54,552,691	V278A	probably benign	Het
4932415D10Rik	G	A	10: 82,291,297	R1960W	possibly damaging	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abce1	C	A	8: 79,685,256	G592*	probably null	Het
Acad10	A	C	5: 121,649,475	V137G	possibly damaging	Het
Adcy3	A	G	12: 4,203,563	I672V	not run	Het
Adgrb1	A	T	15: 74,580,663	Q1166L	possibly damaging	Het
Ankrd44	A	T	1: 54,729,796	N465K	probably damaging	Het
Avpr1b	A	G	1: 131,609,731	T418A	probably benign	Het
Azin1	G	A	15: 38,501,408	T33I	probably damaging	Het
Bicra	T	C	7: 15,972,500	T1339A	probably damaging	Het
Cacna1s	A	G	1: 136,073,708	Y299C	probably damaging	Het
Clip1	A	C	5: 123,613,794	C641W		Het
Clip3	T	C	7: 30,305,812	S524P	probably damaging	Het
Cnpy4	A	T	5: 138,192,882	H240L	probably benign	Het
Cyp2b19	T	C	7: 26,766,914	Y381H	probably damaging	Het
Cyp3a13	T	A	5: 137,905,556	N280I	probably benign	Het
Diaph3	A	G	14: 86,866,584	F788S	probably damaging	Het
Drc7	A	G	8: 95,071,579	N484S	probably damaging	Het
Erap1	G	A	13: 74,673,784		probably null	Het
Fat4	A	T	3: 38,889,693	I912F	probably damaging	Het
Hsd3b3	T	A	3: 98,742,357	K217*	probably null	Het
Igkv12-89	A	G	6: 68,835,077	V36A	probably damaging	Het
Invs	T	A	4: 48,392,526		probably null	Het
Ipo8	T	A	6: 148,824,481	Y30F	possibly damaging	Het
Kctd14	T	C	7: 97,451,486	M1T	probably null	Het
Klrb1c	A	T	6: 128,784,257	C136S	probably benign	Het
Morn2	A	G	17: 80,297,259	E48G	probably damaging	Het
Myh1	A	T	11: 67,201,844		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nfxl1	A	G	5: 72,529,050	S603P	probably benign	Het
Nlrc3	G	A	16: 3,947,877	A351V	probably benign	Het
Nlrp4f	G	A	13: 65,195,538	R76*	probably null	Het
Olfr190	A	T	16: 59,074,192	M296K	probably benign	Het
Olfr228	A	T	2: 86,483,139	I201N	probably damaging	Het
Olfr397	T	C	11: 73,964,808	S67P	probably damaging	Het
Olfr664	G	T	7: 104,733,593	T257K	probably damaging	Het
Olfr872	A	C	9: 20,260,259	I140L	probably damaging	Het
Papolg	A	G	11: 23,867,394	V601A	not run	Het
Pde4dip	T	C	3: 97,758,882	T349A	probably benign	Het
Pdlim5	T	C	3: 142,311,980		probably null	Het
Pkhd1l1	A	G	15: 44,503,280	N718S	probably benign	Het
Plcxd3	A	G	15: 4,516,919	H135R	probably damaging	Het
Plxna2	A	T	1: 194,644,883	Y375F	probably damaging	Het
Prkca	C	T	11: 108,340,645		probably null	Het
Prkdc	A	G	16: 15,717,764	S1663G	probably benign	Het
Ptbp3	T	C	4: 59,514,384	T80A	probably benign	Het
Ptpn4	C	T	1: 119,682,531	V696I	possibly damaging	Het
Rftn1	A	G	17: 50,047,441	Y298H	probably damaging	Het
Rit2	A	G	18: 31,316,839		probably null	Het
Runx1t1	G	A	4: 13,846,935	G240R	probably damaging	Het
Scn10a	A	G	9: 119,664,779		probably null	Het
Serpina16	A	C	12: 103,672,432		probably null	Het
Slc17a3	A	T	13: 23,855,848	M290L		Het
Slc6a4	A	T	11: 77,010,696	M86L	probably benign	Het
Spag7	A	T	11: 70,665,313	V46E	probably benign	Het
Sptlc1	T	C	13: 53,344,878	I271V	probably benign	Het
Stk17b	A	C	1: 53,757,515	H364Q	probably benign	Het
Strc	T	C	2: 121,379,452	H130R	probably damaging	Het
Stxbp1	T	A	2: 32,815,014	D148V	probably damaging	Het
Tirap	G	A	9: 35,188,929	P153L	probably damaging	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tmem51	T	A	4: 142,031,783	D218V	probably damaging	Het
Trim40	A	T	17: 36,882,662	D218E	probably benign	Het
Ttc21b	T	C	2: 66,208,718	D934G	probably damaging	Het
Vmn2r26	T	C	6: 124,025,955	L108P	probably damaging	Het
Washc2	C	A	6: 116,227,418	P429Q	probably damaging	Het
Wipi1	A	G	11: 109,611,311	M1T	probably null	Het
Zfp438	A	G	18: 5,214,712	V82A	probably damaging	Het
Zfp853	G	C	5: 143,287,738	A724G	unknown	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R1647:Pygl	UTSW	12	70197010	missense	possibly damaging	0.60
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4707:Pygl	UTSW	12	70207758	missense	possibly damaging	0.69
R4908:Pygl	UTSW	12	70197033	missense	probably null
R4940:Pygl	UTSW	12	70206381	missense	probably damaging	1.00
R5077:Pygl	UTSW	12	70201892	missense	probably benign	0.14
R5186:Pygl	UTSW	12	70201344	missense	probably damaging	1.00
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R5957:Pygl	UTSW	12	70199720	missense	probably damaging	0.99
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R6024:Pygl	UTSW	12	70197067	missense	probably benign	0.09
R7050:Pygl	UTSW	12	70219622	missense	probably damaging	1.00
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7360:Pygl	UTSW	12	70227532	missense	probably benign	0.11
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R7886:Pygl	UTSW	12	70206356	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CACATAGGTTCTTTGCTCAGGAAAC -3'
(R):5'- AGCCCAGTAAATATCAATGTGCAG -3'

Sequencing Primer
(F):5'- TTGCTCAGGAAACTTACCCAGTGG -3'
(R):5'- TCCCGATAGAAGACTCGTGTG -3'

Posted On

2019-06-26