Incidental Mutation 'R0584:Umps'
ID56582
Institutional Source Beutler Lab
Gene Symbol Umps
Ensembl Gene ENSMUSG00000022814
Gene Nameuridine monophosphate synthetase
Synonyms1700095D23Rik
MMRRC Submission 038774-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R0584 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33954782-33967038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33959124 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 401 (I401T)
Ref Sequence ENSEMBL: ENSMUSP00000023510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023510] [ENSMUST00000131990]
Predicted Effect probably damaging
Transcript: ENSMUST00000023510
AA Change: I401T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023510
Gene: ENSMUSG00000022814
AA Change: I401T

DomainStartEndE-ValueType
Pfam:Pribosyltran 40 166 3.3e-14 PFAM
Blast:OMPdecase 190 237 1e-12 BLAST
OMPdecase 253 466 4.17e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131990
SMART Domains Protein: ENSMUSP00000119423
Gene: ENSMUSG00000022814

DomainStartEndE-ValueType
SCOP:d1lh0a_ 6 53 2e-5 SMART
PDB:2WNS|B 7 57 6e-25 PDB
Meta Mutation Damage Score 0.9306 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine 5'-monophosphate synthase. The encoded protein is a bifunctional enzyme that catalyzes the final two steps of the de novo pyrimidine biosynthetic pathway. The first reaction is carried out by the N-terminal enzyme orotate phosphoribosyltransferase which converts orotic acid to orotidine-5'-monophosphate. The terminal reaction is carried out by the C-terminal enzyme OMP decarboxylase which converts orotidine-5'-monophosphate to uridine monophosphate. Defects in this gene are the cause of hereditary orotic aciduria. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,011,730 S1745P probably damaging Het
Agfg2 G A 5: 137,667,730 T89I probably damaging Het
Agtr1a A G 13: 30,381,034 I27M probably damaging Het
Armh1 A T 4: 117,229,850 L206Q probably damaging Het
Asxl2 A T 12: 3,496,632 E472V probably damaging Het
Atp2c2 T A 8: 119,738,418 V313E probably benign Het
Casp12 A G 9: 5,352,268 I87V probably null Het
Ccl25 C T 8: 4,354,085 probably benign Het
Col9a1 T C 1: 24,224,490 probably benign Het
Cyth4 A G 15: 78,609,878 probably null Het
Dnah9 A G 11: 65,990,489 Y2587H probably damaging Het
Dppa3 T C 6: 122,629,992 I147T probably benign Het
Fam120b T C 17: 15,402,122 S121P probably damaging Het
Fam209 C T 2: 172,474,161 T152M probably benign Het
Fam98a A G 17: 75,544,777 L103P probably damaging Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fitm1 T C 14: 55,576,656 V203A probably benign Het
Gcn1l1 G A 5: 115,595,015 R1037Q probably damaging Het
Gm11563 A G 11: 99,658,625 I101T unknown Het
Gpd1l A G 9: 114,914,344 F163L probably damaging Het
Grp C A 18: 65,873,695 A30E possibly damaging Het
H1fnt C A 15: 98,257,077 E64* probably null Het
Icosl T C 10: 78,071,875 Y90H possibly damaging Het
Itsn2 A G 12: 4,697,180 T1194A probably benign Het
Lrp6 A G 6: 134,456,076 S1431P probably damaging Het
Ltbp1 T C 17: 75,363,472 S1503P probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Myh13 G T 11: 67,360,374 E1360* probably null Het
Nop58 A G 1: 59,706,760 D400G probably benign Het
Olfr507 T C 7: 108,622,415 L201P probably benign Het
Olfr775 T C 10: 129,250,948 V138A probably benign Het
Oscp1 A G 4: 126,083,594 probably null Het
Pde9a A T 17: 31,459,977 Y264F probably damaging Het
Pkhd1 T A 1: 20,239,436 K2763* probably null Het
Prkci T A 3: 31,025,140 C42* probably null Het
Ptprr T C 10: 116,251,158 V270A probably damaging Het
Rsf1 T A 7: 97,662,128 N688K possibly damaging Het
S1pr3 A T 13: 51,419,661 M293L probably benign Het
Scn10a A C 9: 119,670,531 L232R probably damaging Het
Sirt5 T A 13: 43,394,728 probably null Het
Sp6 C T 11: 97,022,265 T268M probably damaging Het
Spag5 A G 11: 78,304,095 N76S possibly damaging Het
Tecta T C 9: 42,347,908 N1560D possibly damaging Het
Togaram1 T C 12: 64,967,505 L510P probably damaging Het
Vars2 A G 17: 35,666,686 V118A possibly damaging Het
Other mutations in Umps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Umps APN 16 33966902 missense probably damaging 1.00
IGL02833:Umps APN 16 33962153 nonsense probably null
R2888:Umps UTSW 16 33963870 missense probably damaging 1.00
R4125:Umps UTSW 16 33956918 nonsense probably null
R4428:Umps UTSW 16 33961586 missense probably damaging 1.00
R5261:Umps UTSW 16 33966974 missense probably benign 0.00
R6030:Umps UTSW 16 33962138 missense probably benign
R6030:Umps UTSW 16 33962138 missense probably benign
R7066:Umps UTSW 16 33961733 nonsense probably null
Z1088:Umps UTSW 16 33966825 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGGTCAAAAGGCTCACCCATTG -3'
(R):5'- TGTCAGATCTTCTCAGGCATGGCTC -3'

Sequencing Primer
(F):5'- agaaatgctgaccctgcc -3'
(R):5'- ATGGCTCCTTGGGCGAAG -3'
Posted On2013-07-11