Incidental Mutation 'R7283:Sptlc1'
ID565821
Institutional Source Beutler Lab
Gene Symbol Sptlc1
Ensembl Gene ENSMUSG00000021468
Gene Nameserine palmitoyltransferase, long chain base subunit 1
SynonymsLcb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7283 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location53332748-53377397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53344878 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 271 (I271V)
Ref Sequence ENSEMBL: ENSMUSP00000021920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021920]
Predicted Effect probably benign
Transcript: ENSMUST00000021920
AA Change: I271V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021920
Gene: ENSMUSG00000021468
AA Change: I271V

DomainStartEndE-ValueType
transmembrane domain 20 40 N/A INTRINSIC
Pfam:Aminotran_1_2 98 464 9.5e-44 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-II pyridoxal-phosphate-dependent aminotransferase family. The encoded protein is the long chain base subunit 1 of serine palmitoyltransferase. Serine palmitoyltransferase converts L-serine and palmitoyl-CoA to 3-oxosphinganine with pyridoxal 5'-phosphate and is the key enzyme in sphingolipid biosynthesis. Mutations in this gene were identified in patients with hereditary sensory neuropathy type 1. Alternatively spliced variants encoding different isoforms have been identified. Pseudogenes of this gene have been defined on chromosomes 1, 6, 10, and 13. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a knock-out allele exhibit abnormal sphingolipid levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,274,828 Q1346R probably damaging Het
4833439L19Rik A G 13: 54,552,691 V278A probably benign Het
4932415D10Rik G A 10: 82,291,297 R1960W possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abce1 C A 8: 79,685,256 G592* probably null Het
Acad10 A C 5: 121,649,475 V137G possibly damaging Het
Adcy3 A G 12: 4,203,563 I672V not run Het
Adgrb1 A T 15: 74,580,663 Q1166L possibly damaging Het
Ankrd44 A T 1: 54,729,796 N465K probably damaging Het
Avpr1b A G 1: 131,609,731 T418A probably benign Het
Azin1 G A 15: 38,501,408 T33I probably damaging Het
Bicra T C 7: 15,972,500 T1339A probably damaging Het
Cacna1s A G 1: 136,073,708 Y299C probably damaging Het
Clip1 A C 5: 123,613,794 C641W Het
Clip3 T C 7: 30,305,812 S524P probably damaging Het
Cnpy4 A T 5: 138,192,882 H240L probably benign Het
Cyp2b19 T C 7: 26,766,914 Y381H probably damaging Het
Cyp3a13 T A 5: 137,905,556 N280I probably benign Het
Diaph3 A G 14: 86,866,584 F788S probably damaging Het
Drc7 A G 8: 95,071,579 N484S probably damaging Het
Erap1 G A 13: 74,673,784 probably null Het
Fat4 A T 3: 38,889,693 I912F probably damaging Het
Hsd3b3 T A 3: 98,742,357 K217* probably null Het
Igkv12-89 A G 6: 68,835,077 V36A probably damaging Het
Invs T A 4: 48,392,526 probably null Het
Ipo8 T A 6: 148,824,481 Y30F possibly damaging Het
Kctd14 T C 7: 97,451,486 M1T probably null Het
Klrb1c A T 6: 128,784,257 C136S probably benign Het
Morn2 A G 17: 80,297,259 E48G probably damaging Het
Myh1 A T 11: 67,201,844 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfxl1 A G 5: 72,529,050 S603P probably benign Het
Nlrc3 G A 16: 3,947,877 A351V probably benign Het
Nlrp4f G A 13: 65,195,538 R76* probably null Het
Olfr190 A T 16: 59,074,192 M296K probably benign Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr397 T C 11: 73,964,808 S67P probably damaging Het
Olfr664 G T 7: 104,733,593 T257K probably damaging Het
Olfr872 A C 9: 20,260,259 I140L probably damaging Het
Papolg A G 11: 23,867,394 V601A not run Het
Pde4dip T C 3: 97,758,882 T349A probably benign Het
Pdlim5 T C 3: 142,311,980 probably null Het
Pkhd1l1 A G 15: 44,503,280 N718S probably benign Het
Plcxd3 A G 15: 4,516,919 H135R probably damaging Het
Plxna2 A T 1: 194,644,883 Y375F probably damaging Het
Prkca C T 11: 108,340,645 probably null Het
Prkdc A G 16: 15,717,764 S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 T80A probably benign Het
Ptpn4 C T 1: 119,682,531 V696I possibly damaging Het
Pygl A T 12: 70,216,568 W175R possibly damaging Het
Rftn1 A G 17: 50,047,441 Y298H probably damaging Het
Rit2 A G 18: 31,316,839 probably null Het
Runx1t1 G A 4: 13,846,935 G240R probably damaging Het
Scn10a A G 9: 119,664,779 probably null Het
Serpina16 A C 12: 103,672,432 probably null Het
Slc17a3 A T 13: 23,855,848 M290L Het
Slc6a4 A T 11: 77,010,696 M86L probably benign Het
Spag7 A T 11: 70,665,313 V46E probably benign Het
Stk17b A C 1: 53,757,515 H364Q probably benign Het
Strc T C 2: 121,379,452 H130R probably damaging Het
Stxbp1 T A 2: 32,815,014 D148V probably damaging Het
Tirap G A 9: 35,188,929 P153L probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem51 T A 4: 142,031,783 D218V probably damaging Het
Trim40 A T 17: 36,882,662 D218E probably benign Het
Ttc21b T C 2: 66,208,718 D934G probably damaging Het
Vmn2r26 T C 6: 124,025,955 L108P probably damaging Het
Washc2 C A 6: 116,227,418 P429Q probably damaging Het
Wipi1 A G 11: 109,611,311 M1T probably null Het
Zfp438 A G 18: 5,214,712 V82A probably damaging Het
Zfp853 G C 5: 143,287,738 A724G unknown Het
Other mutations in Sptlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Sptlc1 APN 13 53367378 missense probably damaging 0.98
IGL01354:Sptlc1 APN 13 53333951 missense probably benign
IGL01773:Sptlc1 APN 13 53377298 missense probably damaging 0.96
IGL01876:Sptlc1 APN 13 53374012 missense probably benign 0.02
R0390:Sptlc1 UTSW 13 53337612 missense probably benign 0.06
R1371:Sptlc1 UTSW 13 53351624 missense probably benign
R1961:Sptlc1 UTSW 13 53358880 missense probably benign
R2179:Sptlc1 UTSW 13 53351639 missense probably damaging 1.00
R2513:Sptlc1 UTSW 13 53337640 missense possibly damaging 0.61
R4357:Sptlc1 UTSW 13 53374032 missense probably damaging 1.00
R4989:Sptlc1 UTSW 13 53351656 missense probably damaging 0.97
R5055:Sptlc1 UTSW 13 53342182 missense probably benign 0.02
R6415:Sptlc1 UTSW 13 53351692 critical splice acceptor site probably null
R6752:Sptlc1 UTSW 13 53335358 missense possibly damaging 0.67
R7548:Sptlc1 UTSW 13 53367932 missense possibly damaging 0.84
R7731:Sptlc1 UTSW 13 53333957 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGCACCTAGAAGAGACATG -3'
(R):5'- TGTATGGCCACCCACACTTC -3'

Sequencing Primer
(F):5'- TGGGCTGACCAGATCCAC -3'
(R):5'- ACCCACACTTCCTTCAGAATGTATTG -3'
Posted On2019-06-26