Mutagenetix > Incidental Mutation

Incidental Mutation 'R7283:Azin1'

565826

Institutional Source

Beutler Lab

Gene Symbol

Azin1

Ensembl Gene

ENSMUSG00000037458

Gene Name

antizyme inhibitor 1

Synonyms

ODC antizyme inhibitor, Oazi, Oazin, 1700085L02Rik

MMRRC Submission

Accession Numbers

Genbank: NM_018745; MGI: 1859169

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38487427-38519266 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 38501408 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 33 (T33I)

Ref Sequence

ENSEMBL: ENSMUSP00000065544 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065308] [ENSMUST00000110329] [ENSMUST00000127848] [ENSMUST00000129589] [ENSMUST00000151319]

AlphaFold

O35484

PDB Structure

Crystal structure of antizyme inhibitor, an ornithine decarboxylase homologous protein [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000065308
AA Change: T33I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000065544
Gene: ENSMUSG00000037458
AA Change: T33I

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	279	5.2e-66	PFAM
Pfam:Orn_DAP_Arg_deC	282	406	1.4e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110328

SMART Domains

Protein: ENSMUSP00000105957
Gene: ENSMUSG00000037458

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	279	9.4e-67	PFAM
Pfam:Orn_DAP_Arg_deC	282	357	7.4e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110329
AA Change: T33I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105958
Gene: ENSMUSG00000037458
AA Change: T33I

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	279	5.4e-69	PFAM
Pfam:Orn_DAP_Arg_deC	283	405	3e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000127848
AA Change: T33I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129589
AA Change: T33I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000117988
Gene: ENSMUSG00000037458
AA Change: T33I

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	154	1.8e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000151319
AA Change: T33I

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119201
Gene: ENSMUSG00000037458
AA Change: T33I

Domain	Start	End	E-Value	Type
Pfam:Orn_Arg_deC_N	44	149	9.5e-34	PFAM

Meta Mutation Damage Score

0.1849

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the antizyme inhibitor family, which plays a role in cell growth and proliferation by maintaining polyamine homeostasis within the cell. Antizyme inhibitors are homologs of ornithine decarboxylase (ODC, the key enzyme in polyamine biosynthesis) that have lost the ability to decarboxylase ornithine; however, retain the ability to bind to antizymes. Antizymes negatively regulate intracellular polyamine levels by binding to ODC and targeting it for degradation, as well as by inhibiting polyamine uptake. Antizyme inhibitors function as positive regulators of polyamine levels by sequestering antizymes and neutralizing their effect. This gene encodes antizyme inhibitor 1, the first member of this gene family that is ubiquitously expressed, and is localized in the nucleus and cytoplasm. Overexpression of antizyme inhibitor 1 gene has been associated with increased proliferation, cellular transformation and tumorigenesis. Gene knockout studies showed that homozygous mutant mice lacking functional antizyme inhibitor 1 gene died at birth with abnormal liver morphology. RNA editing of this gene, predominantly in the liver tissue, has been linked to the progression of hepatocellular carcinoma. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous disruption of this gene results in neonatal lethality, a slight reduction in birth weight, and abnormal liver morphology. [provided by MGI curators]

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,274,828	Q1346R	probably damaging	Het
4833439L19Rik	A	G	13: 54,552,691	V278A	probably benign	Het
4932415D10Rik	G	A	10: 82,291,297	R1960W	possibly damaging	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abce1	C	A	8: 79,685,256	G592*	probably null	Het
Acad10	A	C	5: 121,649,475	V137G	possibly damaging	Het
Adcy3	A	G	12: 4,203,563	I672V	not run	Het
Adgrb1	A	T	15: 74,580,663	Q1166L	possibly damaging	Het
Ankrd44	A	T	1: 54,729,796	N465K	probably damaging	Het
Avpr1b	A	G	1: 131,609,731	T418A	probably benign	Het
Bicra	T	C	7: 15,972,500	T1339A	probably damaging	Het
Cacna1s	A	G	1: 136,073,708	Y299C	probably damaging	Het
Clip1	A	C	5: 123,613,794	C641W		Het
Clip3	T	C	7: 30,305,812	S524P	probably damaging	Het
Cnpy4	A	T	5: 138,192,882	H240L	probably benign	Het
Cyp2b19	T	C	7: 26,766,914	Y381H	probably damaging	Het
Cyp3a13	T	A	5: 137,905,556	N280I	probably benign	Het
Diaph3	A	G	14: 86,866,584	F788S	probably damaging	Het
Drc7	A	G	8: 95,071,579	N484S	probably damaging	Het
Erap1	G	A	13: 74,673,784		probably null	Het
Fat4	A	T	3: 38,889,693	I912F	probably damaging	Het
Hsd3b3	T	A	3: 98,742,357	K217*	probably null	Het
Igkv12-89	A	G	6: 68,835,077	V36A	probably damaging	Het
Invs	T	A	4: 48,392,526		probably null	Het
Ipo8	T	A	6: 148,824,481	Y30F	possibly damaging	Het
Kctd14	T	C	7: 97,451,486	M1T	probably null	Het
Klrb1c	A	T	6: 128,784,257	C136S	probably benign	Het
Morn2	A	G	17: 80,297,259	E48G	probably damaging	Het
Myh1	A	T	11: 67,201,844		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nfxl1	A	G	5: 72,529,050	S603P	probably benign	Het
Nlrc3	G	A	16: 3,947,877	A351V	probably benign	Het
Nlrp4f	G	A	13: 65,195,538	R76*	probably null	Het
Olfr190	A	T	16: 59,074,192	M296K	probably benign	Het
Olfr228	A	T	2: 86,483,139	I201N	probably damaging	Het
Olfr397	T	C	11: 73,964,808	S67P	probably damaging	Het
Olfr664	G	T	7: 104,733,593	T257K	probably damaging	Het
Olfr872	A	C	9: 20,260,259	I140L	probably damaging	Het
Papolg	A	G	11: 23,867,394	V601A	not run	Het
Pde4dip	T	C	3: 97,758,882	T349A	probably benign	Het
Pdlim5	T	C	3: 142,311,980		probably null	Het
Pkhd1l1	A	G	15: 44,503,280	N718S	probably benign	Het
Plcxd3	A	G	15: 4,516,919	H135R	probably damaging	Het
Plxna2	A	T	1: 194,644,883	Y375F	probably damaging	Het
Prkca	C	T	11: 108,340,645		probably null	Het
Prkdc	A	G	16: 15,717,764	S1663G	probably benign	Het
Ptbp3	T	C	4: 59,514,384	T80A	probably benign	Het
Ptpn4	C	T	1: 119,682,531	V696I	possibly damaging	Het
Pygl	A	T	12: 70,216,568	W175R	possibly damaging	Het
Rftn1	A	G	17: 50,047,441	Y298H	probably damaging	Het
Rit2	A	G	18: 31,316,839		probably null	Het
Runx1t1	G	A	4: 13,846,935	G240R	probably damaging	Het
Scn10a	A	G	9: 119,664,779		probably null	Het
Serpina16	A	C	12: 103,672,432		probably null	Het
Slc17a3	A	T	13: 23,855,848	M290L		Het
Slc6a4	A	T	11: 77,010,696	M86L	probably benign	Het
Spag7	A	T	11: 70,665,313	V46E	probably benign	Het
Sptlc1	T	C	13: 53,344,878	I271V	probably benign	Het
Stk17b	A	C	1: 53,757,515	H364Q	probably benign	Het
Strc	T	C	2: 121,379,452	H130R	probably damaging	Het
Stxbp1	T	A	2: 32,815,014	D148V	probably damaging	Het
Tirap	G	A	9: 35,188,929	P153L	probably damaging	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tmem51	T	A	4: 142,031,783	D218V	probably damaging	Het
Trim40	A	T	17: 36,882,662	D218E	probably benign	Het
Ttc21b	T	C	2: 66,208,718	D934G	probably damaging	Het
Vmn2r26	T	C	6: 124,025,955	L108P	probably damaging	Het
Washc2	C	A	6: 116,227,418	P429Q	probably damaging	Het
Wipi1	A	G	11: 109,611,311	M1T	probably null	Het
Zfp438	A	G	18: 5,214,712	V82A	probably damaging	Het
Zfp853	G	C	5: 143,287,738	A724G	unknown	Het

Other mutations in Azin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02174:Azin1	APN	15	38493486	missense	probably benign
IGL02406:Azin1	APN	15	38491565	missense	probably benign	0.00
H2330:Azin1	UTSW	15	38497276	missense	probably damaging	0.98
R0562:Azin1	UTSW	15	38493581	missense	probably benign	0.00
R3416:Azin1	UTSW	15	38493546	missense	possibly damaging	0.89
R3434:Azin1	UTSW	15	38493576	missense	probably benign	0.00
R3978:Azin1	UTSW	15	38498713	missense	probably damaging	0.99
R4535:Azin1	UTSW	15	38493605	missense	probably benign	0.11
R4720:Azin1	UTSW	15	38493500	missense	probably benign	0.43
R5266:Azin1	UTSW	15	38491551	missense	probably benign
R6416:Azin1	UTSW	15	38492343	missense	possibly damaging	0.71
R7242:Azin1	UTSW	15	38501505	start codon destroyed	probably null	1.00
R7577:Azin1	UTSW	15	38501421	missense	probably benign	0.01
R7604:Azin1	UTSW	15	38491634	missense	probably damaging	1.00
R8221:Azin1	UTSW	15	38492328	missense	probably damaging	1.00
R8683:Azin1	UTSW	15	38493531	missense	probably damaging	1.00
R9229:Azin1	UTSW	15	38490402	missense	probably benign
R9420:Azin1	UTSW	15	38493627	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GCGATAAACAGGGTTCTATGATTG -3'
(R):5'- ACCCAGACATAGGCTTGGTG -3'

Sequencing Primer
(F):5'- AAACAGGGTTCTATGATTGTTTCCTG -3'
(R):5'- CTTGGTGGCCCGTCTCTTG -3'

Posted On

2019-06-26