Mutagenetix > Incidental Mutation

Incidental Mutation 'R7283:Nlrc3'

565829

Institutional Source

Beutler Lab

Gene Symbol

Nlrc3

Ensembl Gene

ENSMUSG00000049871

Gene Name

NLR family, CARD domain containing 3

Synonyms

CLR16.2, Caterpiller 16.2, D230007K08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R7283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3945007-3976632 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 3947877 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 351 (A351V)

Ref Sequence

ENSEMBL: ENSMUSP00000137325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000177551] [ENSMUST00000180200] [ENSMUST00000229884]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177551
AA Change: A1056V

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000137628
Gene: ENSMUSG00000049871
AA Change: A1056V

Domain	Start	End	E-Value	Type
Pfam:NACHT	176	342	2e-34	PFAM
LRR	702	729	3.11e-2	SMART
LRR	730	757	2.27e-4	SMART
LRR	758	785	8.15e-1	SMART
LRR	786	813	2.17e-1	SMART
LRR	814	841	2.12e-4	SMART
LRR	842	869	3.42e0	SMART
LRR	870	897	7.67e-2	SMART
LRR	898	925	3.21e0	SMART
LRR	926	953	1.67e0	SMART
LRR	954	981	4.87e-4	SMART
LRR	982	1009	4.3e0	SMART
LRR	1010	1037	3.8e-6	SMART
LRR	1038	1065	4.47e-3	SMART
LRR	1066	1093	1.08e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000180200
AA Change: A351V

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000137325
Gene: ENSMUSG00000049871
AA Change: A351V

Domain	Start	End	E-Value	Type
LRR	4	24	8.65e1	SMART
LRR	25	52	2.27e-4	SMART
LRR	53	80	8.15e-1	SMART
LRR	81	108	2.17e-1	SMART
LRR	109	136	2.12e-4	SMART
LRR	137	164	3.42e0	SMART
LRR	165	192	7.67e-2	SMART
LRR	193	220	3.21e0	SMART
LRR	221	248	1.67e0	SMART
LRR	249	276	4.87e-4	SMART
LRR	277	304	4.3e0	SMART
LRR	305	332	3.8e-6	SMART
LRR	333	360	4.47e-3	SMART
LRR	361	388	1.08e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229884
AA Change: A928V

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.5%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a NOD-like receptor family member. The encoded protein is a cytosolic regulator of innate immunity. This protein directly interacts with stimulator of interferon genes (STING), to prevent its proper trafficking, resulting in disruption of STING-dependent activation of the innate immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced susceptibility to LPS-induced toxic shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	G	11: 78,274,828	Q1346R	probably damaging	Het
4833439L19Rik	A	G	13: 54,552,691	V278A	probably benign	Het
4932415D10Rik	G	A	10: 82,291,297	R1960W	possibly damaging	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abce1	C	A	8: 79,685,256	G592*	probably null	Het
Acad10	A	C	5: 121,649,475	V137G	possibly damaging	Het
Adcy3	A	G	12: 4,203,563	I672V	not run	Het
Adgrb1	A	T	15: 74,580,663	Q1166L	possibly damaging	Het
Ankrd44	A	T	1: 54,729,796	N465K	probably damaging	Het
Avpr1b	A	G	1: 131,609,731	T418A	probably benign	Het
Azin1	G	A	15: 38,501,408	T33I	probably damaging	Het
Bicra	T	C	7: 15,972,500	T1339A	probably damaging	Het
Cacna1s	A	G	1: 136,073,708	Y299C	probably damaging	Het
Clip1	A	C	5: 123,613,794	C641W		Het
Clip3	T	C	7: 30,305,812	S524P	probably damaging	Het
Cnpy4	A	T	5: 138,192,882	H240L	probably benign	Het
Cyp2b19	T	C	7: 26,766,914	Y381H	probably damaging	Het
Cyp3a13	T	A	5: 137,905,556	N280I	probably benign	Het
Diaph3	A	G	14: 86,866,584	F788S	probably damaging	Het
Drc7	A	G	8: 95,071,579	N484S	probably damaging	Het
Erap1	G	A	13: 74,673,784		probably null	Het
Fat4	A	T	3: 38,889,693	I912F	probably damaging	Het
Hsd3b3	T	A	3: 98,742,357	K217*	probably null	Het
Igkv12-89	A	G	6: 68,835,077	V36A	probably damaging	Het
Invs	T	A	4: 48,392,526		probably null	Het
Ipo8	T	A	6: 148,824,481	Y30F	possibly damaging	Het
Kctd14	T	C	7: 97,451,486	M1T	probably null	Het
Klrb1c	A	T	6: 128,784,257	C136S	probably benign	Het
Morn2	A	G	17: 80,297,259	E48G	probably damaging	Het
Myh1	A	T	11: 67,201,844		probably null	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nfxl1	A	G	5: 72,529,050	S603P	probably benign	Het
Nlrp4f	G	A	13: 65,195,538	R76*	probably null	Het
Olfr190	A	T	16: 59,074,192	M296K	probably benign	Het
Olfr228	A	T	2: 86,483,139	I201N	probably damaging	Het
Olfr397	T	C	11: 73,964,808	S67P	probably damaging	Het
Olfr664	G	T	7: 104,733,593	T257K	probably damaging	Het
Olfr872	A	C	9: 20,260,259	I140L	probably damaging	Het
Papolg	A	G	11: 23,867,394	V601A	not run	Het
Pde4dip	T	C	3: 97,758,882	T349A	probably benign	Het
Pdlim5	T	C	3: 142,311,980		probably null	Het
Pkhd1l1	A	G	15: 44,503,280	N718S	probably benign	Het
Plcxd3	A	G	15: 4,516,919	H135R	probably damaging	Het
Plxna2	A	T	1: 194,644,883	Y375F	probably damaging	Het
Prkca	C	T	11: 108,340,645		probably null	Het
Prkdc	A	G	16: 15,717,764	S1663G	probably benign	Het
Ptbp3	T	C	4: 59,514,384	T80A	probably benign	Het
Ptpn4	C	T	1: 119,682,531	V696I	possibly damaging	Het
Pygl	A	T	12: 70,216,568	W175R	possibly damaging	Het
Rftn1	A	G	17: 50,047,441	Y298H	probably damaging	Het
Rit2	A	G	18: 31,316,839		probably null	Het
Runx1t1	G	A	4: 13,846,935	G240R	probably damaging	Het
Scn10a	A	G	9: 119,664,779		probably null	Het
Serpina16	A	C	12: 103,672,432		probably null	Het
Slc17a3	A	T	13: 23,855,848	M290L		Het
Slc6a4	A	T	11: 77,010,696	M86L	probably benign	Het
Spag7	A	T	11: 70,665,313	V46E	probably benign	Het
Sptlc1	T	C	13: 53,344,878	I271V	probably benign	Het
Stk17b	A	C	1: 53,757,515	H364Q	probably benign	Het
Strc	T	C	2: 121,379,452	H130R	probably damaging	Het
Stxbp1	T	A	2: 32,815,014	D148V	probably damaging	Het
Tirap	G	A	9: 35,188,929	P153L	probably damaging	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tmem51	T	A	4: 142,031,783	D218V	probably damaging	Het
Trim40	A	T	17: 36,882,662	D218E	probably benign	Het
Ttc21b	T	C	2: 66,208,718	D934G	probably damaging	Het
Vmn2r26	T	C	6: 124,025,955	L108P	probably damaging	Het
Washc2	C	A	6: 116,227,418	P429Q	probably damaging	Het
Wipi1	A	G	11: 109,611,311	M1T	probably null	Het
Zfp438	A	G	18: 5,214,712	V82A	probably damaging	Het
Zfp853	G	C	5: 143,287,738	A724G	unknown	Het

Other mutations in Nlrc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Nlrc3	APN	16	3955166	missense	probably damaging	1.00
IGL00943:Nlrc3	APN	16	3965117	missense	possibly damaging	0.94
IGL01481:Nlrc3	APN	16	3963905	missense	probably damaging	1.00
IGL01517:Nlrc3	APN	16	3947487	missense	probably damaging	0.99
IGL01988:Nlrc3	APN	16	3953939	missense	probably benign	0.43
IGL02306:Nlrc3	APN	16	3964824	missense	probably damaging	1.00
IGL02515:Nlrc3	APN	16	3949459	splice site	probably benign
IGL02795:Nlrc3	APN	16	3965285	missense	probably damaging	0.99
IGL02897:Nlrc3	APN	16	3964074	missense	possibly damaging	0.85
IGL02992:Nlrc3	APN	16	3954023	splice site	probably benign
IGL03003:Nlrc3	APN	16	3964862	missense	probably benign	0.03
IGL03381:Nlrc3	APN	16	3964315	missense	probably benign	0.03
R0064:Nlrc3	UTSW	16	3964087	missense	possibly damaging	0.82
R0064:Nlrc3	UTSW	16	3964087	missense	possibly damaging	0.82
R0122:Nlrc3	UTSW	16	3958958	missense	probably damaging	0.98
R0482:Nlrc3	UTSW	16	3965192	missense	possibly damaging	0.81
R0601:Nlrc3	UTSW	16	3948249	splice site	probably benign
R0622:Nlrc3	UTSW	16	3953968	missense	probably benign	0.04
R0675:Nlrc3	UTSW	16	3948911	missense	probably benign	0.01
R1595:Nlrc3	UTSW	16	3965302	missense	probably benign	0.03
R1597:Nlrc3	UTSW	16	3963995	missense	probably damaging	1.00
R2013:Nlrc3	UTSW	16	3965110	missense	probably damaging	1.00
R2077:Nlrc3	UTSW	16	3963992	missense	probably benign	0.35
R2327:Nlrc3	UTSW	16	3953440	missense	probably damaging	1.00
R2872:Nlrc3	UTSW	16	3957326	missense	possibly damaging	0.56
R2872:Nlrc3	UTSW	16	3957326	missense	possibly damaging	0.56
R3037:Nlrc3	UTSW	16	3952408	missense	probably damaging	1.00
R3794:Nlrc3	UTSW	16	3947875	missense	probably benign	0.22
R3843:Nlrc3	UTSW	16	3964964	missense	probably benign
R4761:Nlrc3	UTSW	16	3963650	missense	probably damaging	1.00
R5303:Nlrc3	UTSW	16	3963614	missense	probably benign	0.15
R5375:Nlrc3	UTSW	16	3964753	missense	possibly damaging	0.95
R5468:Nlrc3	UTSW	16	3964035	missense	probably damaging	1.00
R5719:Nlrc3	UTSW	16	3963725	missense	probably damaging	1.00
R5838:Nlrc3	UTSW	16	3953995	missense	probably damaging	1.00
R5879:Nlrc3	UTSW	16	3964045	missense	probably damaging	1.00
R5942:Nlrc3	UTSW	16	3949429	missense	probably damaging	1.00
R6500:Nlrc3	UTSW	16	3952444	missense	possibly damaging	0.79
R6600:Nlrc3	UTSW	16	3965074	missense	probably benign	0.29
R6704:Nlrc3	UTSW	16	3965081	missense	probably damaging	0.99
R7172:Nlrc3	UTSW	16	3963753	missense	probably benign	0.30
R7296:Nlrc3	UTSW	16	3963590	missense	probably damaging	0.99
R7477:Nlrc3	UTSW	16	3964811	missense	probably damaging	0.99
R7817:Nlrc3	UTSW	16	3965463	missense	possibly damaging	0.87
R8118:Nlrc3	UTSW	16	3965631	missense	probably benign
R8559:Nlrc3	UTSW	16	3965282	missense	probably benign	0.05
R8871:Nlrc3	UTSW	16	3964104	intron	probably benign
R9008:Nlrc3	UTSW	16	3958943	missense	possibly damaging	0.95
R9237:Nlrc3	UTSW	16	3965209	missense	probably benign	0.02
R9385:Nlrc3	UTSW	16	3964012	missense	probably damaging	1.00
R9430:Nlrc3	UTSW	16	3965532	missense	probably benign	0.00
R9509:Nlrc3	UTSW	16	3964816	missense	probably damaging	1.00
R9573:Nlrc3	UTSW	16	3953977	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- AGGACCCTACTGAATTTGCCC -3'
(R):5'- AGCTTAGAGGTCAAATGTCAGTC -3'

Sequencing Primer
(F):5'- TAGACCTAGTCTCCCCGTGG -3'
(R):5'- GTCAAATGTCAGTCTAGCAGTTGC -3'

Posted On

2019-06-26