Incidental Mutation 'R0584:Fam120b'
ID56583
Institutional Source Beutler Lab
Gene Symbol Fam120b
Ensembl Gene ENSMUSG00000014763
Gene Namefamily with sequence similarity 120, member B
SynonymsCCPG, 4932442K08Rik
MMRRC Submission 038774-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0584 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15396202-15433583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15402122 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 121 (S121P)
Ref Sequence ENSEMBL: ENSMUSP00000054420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055352]
Predicted Effect probably damaging
Transcript: ENSMUST00000055352
AA Change: S121P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054420
Gene: ENSMUSG00000014763
AA Change: S121P

DomainStartEndE-ValueType
Blast:XPGN 1 111 7e-46 BLAST
SCOP:d1a77_2 21 185 6e-8 SMART
internal_repeat_1 324 364 9.23e-10 PROSPERO
internal_repeat_1 372 412 9.23e-10 PROSPERO
low complexity region 650 664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231318
Meta Mutation Damage Score 0.1946 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,011,730 S1745P probably damaging Het
Agfg2 G A 5: 137,667,730 T89I probably damaging Het
Agtr1a A G 13: 30,381,034 I27M probably damaging Het
Armh1 A T 4: 117,229,850 L206Q probably damaging Het
Asxl2 A T 12: 3,496,632 E472V probably damaging Het
Atp2c2 T A 8: 119,738,418 V313E probably benign Het
Casp12 A G 9: 5,352,268 I87V probably null Het
Ccl25 C T 8: 4,354,085 probably benign Het
Col9a1 T C 1: 24,224,490 probably benign Het
Cyth4 A G 15: 78,609,878 probably null Het
Dnah9 A G 11: 65,990,489 Y2587H probably damaging Het
Dppa3 T C 6: 122,629,992 I147T probably benign Het
Fam209 C T 2: 172,474,161 T152M probably benign Het
Fam98a A G 17: 75,544,777 L103P probably damaging Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fitm1 T C 14: 55,576,656 V203A probably benign Het
Gcn1l1 G A 5: 115,595,015 R1037Q probably damaging Het
Gm11563 A G 11: 99,658,625 I101T unknown Het
Gpd1l A G 9: 114,914,344 F163L probably damaging Het
Grp C A 18: 65,873,695 A30E possibly damaging Het
H1fnt C A 15: 98,257,077 E64* probably null Het
Icosl T C 10: 78,071,875 Y90H possibly damaging Het
Itsn2 A G 12: 4,697,180 T1194A probably benign Het
Lrp6 A G 6: 134,456,076 S1431P probably damaging Het
Ltbp1 T C 17: 75,363,472 S1503P probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Myh13 G T 11: 67,360,374 E1360* probably null Het
Nop58 A G 1: 59,706,760 D400G probably benign Het
Olfr507 T C 7: 108,622,415 L201P probably benign Het
Olfr775 T C 10: 129,250,948 V138A probably benign Het
Oscp1 A G 4: 126,083,594 probably null Het
Pde9a A T 17: 31,459,977 Y264F probably damaging Het
Pkhd1 T A 1: 20,239,436 K2763* probably null Het
Prkci T A 3: 31,025,140 C42* probably null Het
Ptprr T C 10: 116,251,158 V270A probably damaging Het
Rsf1 T A 7: 97,662,128 N688K possibly damaging Het
S1pr3 A T 13: 51,419,661 M293L probably benign Het
Scn10a A C 9: 119,670,531 L232R probably damaging Het
Sirt5 T A 13: 43,394,728 probably null Het
Sp6 C T 11: 97,022,265 T268M probably damaging Het
Spag5 A G 11: 78,304,095 N76S possibly damaging Het
Tecta T C 9: 42,347,908 N1560D possibly damaging Het
Togaram1 T C 12: 64,967,505 L510P probably damaging Het
Umps A G 16: 33,959,124 I401T probably damaging Het
Vars2 A G 17: 35,666,686 V118A possibly damaging Het
Other mutations in Fam120b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam120b APN 17 15402595 nonsense probably null
IGL01874:Fam120b APN 17 15403039 nonsense probably null
IGL02111:Fam120b APN 17 15402585 missense possibly damaging 0.67
IGL02395:Fam120b APN 17 15402515 missense probably damaging 1.00
IGL02901:Fam120b APN 17 15407702 splice site probably benign
IGL03380:Fam120b APN 17 15403134 splice site probably benign
R0139:Fam120b UTSW 17 15426184 splice site probably benign
R0242:Fam120b UTSW 17 15422924 missense probably damaging 1.00
R0242:Fam120b UTSW 17 15422924 missense probably damaging 1.00
R0244:Fam120b UTSW 17 15417637 missense probably damaging 1.00
R0486:Fam120b UTSW 17 15426288 splice site probably benign
R0551:Fam120b UTSW 17 15431643 splice site probably benign
R0620:Fam120b UTSW 17 15402927 missense probably benign
R1606:Fam120b UTSW 17 15401811 missense possibly damaging 0.79
R1638:Fam120b UTSW 17 15402497 missense possibly damaging 0.95
R2022:Fam120b UTSW 17 15424376 missense possibly damaging 0.70
R3411:Fam120b UTSW 17 15431635 splice site probably benign
R4422:Fam120b UTSW 17 15402183 missense probably damaging 1.00
R4754:Fam120b UTSW 17 15422962 missense probably damaging 1.00
R4756:Fam120b UTSW 17 15402396 missense probably damaging 1.00
R4883:Fam120b UTSW 17 15403032 missense probably benign
R5400:Fam120b UTSW 17 15403126 missense possibly damaging 0.55
R5418:Fam120b UTSW 17 15401799 missense probably damaging 1.00
R5632:Fam120b UTSW 17 15403082 missense probably benign 0.08
R5878:Fam120b UTSW 17 15402240 missense probably damaging 1.00
R6030:Fam120b UTSW 17 15401910 missense probably damaging 1.00
R6030:Fam120b UTSW 17 15401910 missense probably damaging 1.00
R6846:Fam120b UTSW 17 15414829 missense probably damaging 1.00
R6929:Fam120b UTSW 17 15423028 missense possibly damaging 0.78
R7356:Fam120b UTSW 17 15407696 missense probably benign 0.05
R7616:Fam120b UTSW 17 15402836 missense possibly damaging 0.79
R7848:Fam120b UTSW 17 15405774 missense possibly damaging 0.93
R7931:Fam120b UTSW 17 15405774 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTCACCGAAACAAGTACCCTGGATG -3'
(R):5'- CAGTTGTGCTGGAGGCCATAAGAAG -3'

Sequencing Primer
(F):5'- CAAGTACCCTGGATGTACGC -3'
(R):5'- TAAGAAGCCACCTCGTAGTCTG -3'
Posted On2013-07-11