Incidental Mutation 'R7283:Or5h22'
ID 565831
Institutional Source Beutler Lab
Gene Symbol Or5h22
Ensembl Gene ENSMUSG00000064006
Gene Name olfactory receptor family 5 subfamily H member 22
Synonyms GA_x54KRFPKG5P-55303207-55302284, Olfr190, MOR183-4
MMRRC Submission 045361-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7283 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 58894518-58895441 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58894555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 296 (M296K)
Ref Sequence ENSEMBL: ENSMUSP00000148991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071243] [ENSMUST00000215687] [ENSMUST00000216495]
AlphaFold K7N5T5
Predicted Effect probably benign
Transcript: ENSMUST00000071243
AA Change: M296K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071224
Gene: ENSMUSG00000064006
AA Change: M296K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-46 PFAM
Pfam:7tm_1 39 288 2.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215687
AA Change: M296K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216495
AA Change: M296K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833439L19Rik A G 13: 54,700,504 (GRCm39) V278A probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abce1 C A 8: 80,411,885 (GRCm39) G592* probably null Het
Acad10 A C 5: 121,787,538 (GRCm39) V137G possibly damaging Het
Adcy3 A G 12: 4,253,563 (GRCm39) I672V not run Het
Adgrb1 A T 15: 74,452,512 (GRCm39) Q1166L possibly damaging Het
Ankrd44 A T 1: 54,768,955 (GRCm39) N465K probably damaging Het
Avpr1b A G 1: 131,537,469 (GRCm39) T418A probably benign Het
Azin1 G A 15: 38,501,652 (GRCm39) T33I probably damaging Het
Bicra T C 7: 15,706,425 (GRCm39) T1339A probably damaging Het
Bltp2 A G 11: 78,165,654 (GRCm39) Q1346R probably damaging Het
Cacna1s A G 1: 136,001,446 (GRCm39) Y299C probably damaging Het
Clip1 A C 5: 123,751,857 (GRCm39) C641W Het
Clip3 T C 7: 30,005,237 (GRCm39) S524P probably damaging Het
Cnpy4 A T 5: 138,191,144 (GRCm39) H240L probably benign Het
Cyp2b19 T C 7: 26,466,339 (GRCm39) Y381H probably damaging Het
Cyp3a13 T A 5: 137,903,818 (GRCm39) N280I probably benign Het
Diaph3 A G 14: 87,104,020 (GRCm39) F788S probably damaging Het
Drc7 A G 8: 95,798,207 (GRCm39) N484S probably damaging Het
Erap1 G A 13: 74,821,903 (GRCm39) probably null Het
Fat4 A T 3: 38,943,842 (GRCm39) I912F probably damaging Het
Hsd3b3 T A 3: 98,649,673 (GRCm39) K217* probably null Het
Igkv12-89 A G 6: 68,812,061 (GRCm39) V36A probably damaging Het
Invs T A 4: 48,392,526 (GRCm39) probably null Het
Ipo8 T A 6: 148,725,979 (GRCm39) Y30F possibly damaging Het
Kctd14 T C 7: 97,100,693 (GRCm39) M1T probably null Het
Klrb1c A T 6: 128,761,220 (GRCm39) C136S probably benign Het
Morn2 A G 17: 80,604,688 (GRCm39) E48G probably damaging Het
Myh1 A T 11: 67,092,670 (GRCm39) probably null Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nfxl1 A G 5: 72,686,393 (GRCm39) S603P probably benign Het
Nlrc3 G A 16: 3,765,741 (GRCm39) A351V probably benign Het
Nlrp4f G A 13: 65,343,352 (GRCm39) R76* probably null Het
Or1e1f T C 11: 73,855,634 (GRCm39) S67P probably damaging Het
Or52n1 G T 7: 104,382,800 (GRCm39) T257K probably damaging Het
Or7e176 A C 9: 20,171,555 (GRCm39) I140L probably damaging Het
Or8k41 A T 2: 86,313,483 (GRCm39) I201N probably damaging Het
Papolg A G 11: 23,817,394 (GRCm39) V601A not run Het
Pde4dip T C 3: 97,666,198 (GRCm39) T349A probably benign Het
Pdlim5 T C 3: 142,017,741 (GRCm39) probably null Het
Pkhd1l1 A G 15: 44,366,676 (GRCm39) N718S probably benign Het
Plcxd3 A G 15: 4,546,401 (GRCm39) H135R probably damaging Het
Plxna2 A T 1: 194,327,191 (GRCm39) Y375F probably damaging Het
Prkca C T 11: 108,231,471 (GRCm39) probably null Het
Prkdc A G 16: 15,535,628 (GRCm39) S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 (GRCm39) T80A probably benign Het
Ptpn4 C T 1: 119,610,261 (GRCm39) V696I possibly damaging Het
Pygl A T 12: 70,263,342 (GRCm39) W175R possibly damaging Het
Rftn1 A G 17: 50,354,469 (GRCm39) Y298H probably damaging Het
Rit2 A G 18: 31,449,892 (GRCm39) probably null Het
Runx1t1 G A 4: 13,846,935 (GRCm39) G240R probably damaging Het
Scn10a A G 9: 119,493,845 (GRCm39) probably null Het
Serpina16 A C 12: 103,638,691 (GRCm39) probably null Het
Slc17a3 A T 13: 24,039,831 (GRCm39) M290L Het
Slc6a4 A T 11: 76,901,522 (GRCm39) M86L probably benign Het
Spag7 A T 11: 70,556,139 (GRCm39) V46E probably benign Het
Spata31h1 G A 10: 82,127,131 (GRCm39) R1960W possibly damaging Het
Sptlc1 T C 13: 53,498,914 (GRCm39) I271V probably benign Het
Stk17b A C 1: 53,796,674 (GRCm39) H364Q probably benign Het
Strc T C 2: 121,209,933 (GRCm39) H130R probably damaging Het
Stxbp1 T A 2: 32,705,026 (GRCm39) D148V probably damaging Het
Tirap G A 9: 35,100,225 (GRCm39) P153L probably damaging Het
Tmco3 G A 8: 13,369,605 (GRCm39) probably null Het
Tmem51 T A 4: 141,759,094 (GRCm39) D218V probably damaging Het
Trim40 A T 17: 37,193,554 (GRCm39) D218E probably benign Het
Ttc21b T C 2: 66,039,062 (GRCm39) D934G probably damaging Het
Vmn2r26 T C 6: 124,002,914 (GRCm39) L108P probably damaging Het
Washc2 C A 6: 116,204,379 (GRCm39) P429Q probably damaging Het
Wipi1 A G 11: 109,502,137 (GRCm39) M1T probably null Het
Zfp438 A G 18: 5,214,712 (GRCm39) V82A probably damaging Het
Zfp853 G C 5: 143,273,493 (GRCm39) A724G unknown Het
Other mutations in Or5h22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Or5h22 APN 16 58,895,052 (GRCm39) nonsense probably null
IGL01011:Or5h22 APN 16 58,894,793 (GRCm39) missense probably benign 0.10
IGL01453:Or5h22 APN 16 58,895,132 (GRCm39) missense probably benign 0.00
IGL01978:Or5h22 APN 16 58,894,630 (GRCm39) missense probably benign 0.33
IGL02348:Or5h22 APN 16 58,895,312 (GRCm39) missense probably damaging 0.99
IGL02423:Or5h22 APN 16 58,894,630 (GRCm39) missense probably benign 0.33
IGL02628:Or5h22 APN 16 58,895,155 (GRCm39) missense probably benign 0.01
R0220:Or5h22 UTSW 16 58,895,095 (GRCm39) missense probably damaging 1.00
R0471:Or5h22 UTSW 16 58,894,633 (GRCm39) missense probably benign 0.01
R1697:Or5h22 UTSW 16 58,895,270 (GRCm39) missense probably damaging 1.00
R3009:Or5h22 UTSW 16 58,895,350 (GRCm39) missense probably benign 0.01
R3011:Or5h22 UTSW 16 58,895,350 (GRCm39) missense probably benign 0.01
R3027:Or5h22 UTSW 16 58,895,330 (GRCm39) missense probably benign 0.00
R4080:Or5h22 UTSW 16 58,894,619 (GRCm39) missense probably damaging 0.96
R4482:Or5h22 UTSW 16 58,895,286 (GRCm39) missense probably benign 0.02
R4895:Or5h22 UTSW 16 58,895,020 (GRCm39) missense probably benign 0.09
R5409:Or5h22 UTSW 16 58,894,559 (GRCm39) missense possibly damaging 0.94
R5825:Or5h22 UTSW 16 58,895,024 (GRCm39) missense probably benign 0.01
R6146:Or5h22 UTSW 16 58,895,077 (GRCm39) missense probably benign 0.05
R6249:Or5h22 UTSW 16 58,894,795 (GRCm39) missense probably damaging 1.00
R6996:Or5h22 UTSW 16 58,894,555 (GRCm39) missense probably benign 0.00
R7707:Or5h22 UTSW 16 58,894,634 (GRCm39) missense possibly damaging 0.52
R8381:Or5h22 UTSW 16 58,895,225 (GRCm39) missense probably damaging 1.00
R8507:Or5h22 UTSW 16 58,895,243 (GRCm39) missense possibly damaging 0.81
R8887:Or5h22 UTSW 16 58,894,846 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTCTCAGCTGGGTATCAAAAGG -3'
(R):5'- GAAGGCTTTCTCTACCTGTGG -3'

Sequencing Primer
(F):5'- GGGGGCCATTTTTATTCAAATCACC -3'
(R):5'- GTGGTGCCCATCTCTTATCTGTG -3'
Posted On 2019-06-26