Incidental Mutation 'R7283:Trim40'
ID 565832
Institutional Source Beutler Lab
Gene Symbol Trim40
Ensembl Gene ENSMUSG00000073399
Gene Name tripartite motif-containing 40
Synonyms LOC195359, LOC240093, LOC333872
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R7283 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 36881598-36890123 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36882662 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 218 (D218E)
Ref Sequence ENSEMBL: ENSMUSP00000084400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060524] [ENSMUST00000087158] [ENSMUST00000172711]
AlphaFold Q3UWA4
Predicted Effect probably benign
Transcript: ENSMUST00000060524
SMART Domains Protein: ENSMUSP00000057928
Gene: ENSMUSG00000073400

DomainStartEndE-ValueType
RING 16 60 1.2e-7 SMART
BBOX 94 135 5.38e-10 SMART
coiled coil region 152 175 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
PRY 309 361 1.04e-25 SMART
SPRY 362 485 1.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087158
AA Change: D218E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000084400
Gene: ENSMUSG00000073399
AA Change: D218E

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 1.1e-6 PFAM
coiled coil region 106 150 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172711
AA Change: D184E

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133581
Gene: ENSMUSG00000073399
AA Change: D184E

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 3.4e-7 PFAM
coiled coil region 106 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) protein family. The encoded protein may play a role as a negative regulator against inflammation and carcinogenesis in the gastrointestinal tract. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,274,828 Q1346R probably damaging Het
4833439L19Rik A G 13: 54,552,691 V278A probably benign Het
4932415D10Rik G A 10: 82,291,297 R1960W possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abce1 C A 8: 79,685,256 G592* probably null Het
Acad10 A C 5: 121,649,475 V137G possibly damaging Het
Adcy3 A G 12: 4,203,563 I672V not run Het
Adgrb1 A T 15: 74,580,663 Q1166L possibly damaging Het
Ankrd44 A T 1: 54,729,796 N465K probably damaging Het
Avpr1b A G 1: 131,609,731 T418A probably benign Het
Azin1 G A 15: 38,501,408 T33I probably damaging Het
Bicra T C 7: 15,972,500 T1339A probably damaging Het
Cacna1s A G 1: 136,073,708 Y299C probably damaging Het
Clip1 A C 5: 123,613,794 C641W Het
Clip3 T C 7: 30,305,812 S524P probably damaging Het
Cnpy4 A T 5: 138,192,882 H240L probably benign Het
Cyp2b19 T C 7: 26,766,914 Y381H probably damaging Het
Cyp3a13 T A 5: 137,905,556 N280I probably benign Het
Diaph3 A G 14: 86,866,584 F788S probably damaging Het
Drc7 A G 8: 95,071,579 N484S probably damaging Het
Erap1 G A 13: 74,673,784 probably null Het
Fat4 A T 3: 38,889,693 I912F probably damaging Het
Hsd3b3 T A 3: 98,742,357 K217* probably null Het
Igkv12-89 A G 6: 68,835,077 V36A probably damaging Het
Invs T A 4: 48,392,526 probably null Het
Ipo8 T A 6: 148,824,481 Y30F possibly damaging Het
Kctd14 T C 7: 97,451,486 M1T probably null Het
Klrb1c A T 6: 128,784,257 C136S probably benign Het
Morn2 A G 17: 80,297,259 E48G probably damaging Het
Myh1 A T 11: 67,201,844 probably null Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nfxl1 A G 5: 72,529,050 S603P probably benign Het
Nlrc3 G A 16: 3,947,877 A351V probably benign Het
Nlrp4f G A 13: 65,195,538 R76* probably null Het
Olfr190 A T 16: 59,074,192 M296K probably benign Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr397 T C 11: 73,964,808 S67P probably damaging Het
Olfr664 G T 7: 104,733,593 T257K probably damaging Het
Olfr872 A C 9: 20,260,259 I140L probably damaging Het
Papolg A G 11: 23,867,394 V601A not run Het
Pde4dip T C 3: 97,758,882 T349A probably benign Het
Pdlim5 T C 3: 142,311,980 probably null Het
Pkhd1l1 A G 15: 44,503,280 N718S probably benign Het
Plcxd3 A G 15: 4,516,919 H135R probably damaging Het
Plxna2 A T 1: 194,644,883 Y375F probably damaging Het
Prkca C T 11: 108,340,645 probably null Het
Prkdc A G 16: 15,717,764 S1663G probably benign Het
Ptbp3 T C 4: 59,514,384 T80A probably benign Het
Ptpn4 C T 1: 119,682,531 V696I possibly damaging Het
Pygl A T 12: 70,216,568 W175R possibly damaging Het
Rftn1 A G 17: 50,047,441 Y298H probably damaging Het
Rit2 A G 18: 31,316,839 probably null Het
Runx1t1 G A 4: 13,846,935 G240R probably damaging Het
Scn10a A G 9: 119,664,779 probably null Het
Serpina16 A C 12: 103,672,432 probably null Het
Slc17a3 A T 13: 23,855,848 M290L Het
Slc6a4 A T 11: 77,010,696 M86L probably benign Het
Spag7 A T 11: 70,665,313 V46E probably benign Het
Sptlc1 T C 13: 53,344,878 I271V probably benign Het
Stk17b A C 1: 53,757,515 H364Q probably benign Het
Strc T C 2: 121,379,452 H130R probably damaging Het
Stxbp1 T A 2: 32,815,014 D148V probably damaging Het
Tirap G A 9: 35,188,929 P153L probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem51 T A 4: 142,031,783 D218V probably damaging Het
Ttc21b T C 2: 66,208,718 D934G probably damaging Het
Vmn2r26 T C 6: 124,025,955 L108P probably damaging Het
Washc2 C A 6: 116,227,418 P429Q probably damaging Het
Wipi1 A G 11: 109,611,311 M1T probably null Het
Zfp438 A G 18: 5,214,712 V82A probably damaging Het
Zfp853 G C 5: 143,287,738 A724G unknown Het
Other mutations in Trim40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Trim40 APN 17 36882397 makesense probably null
IGL01085:Trim40 APN 17 36883241 missense probably benign 0.01
IGL02071:Trim40 APN 17 36889178 missense probably benign
IGL02343:Trim40 APN 17 36889138 missense probably benign 0.03
R0116:Trim40 UTSW 17 36883147 critical splice donor site probably null
R1853:Trim40 UTSW 17 36889078 missense probably damaging 1.00
R2216:Trim40 UTSW 17 36888983 missense probably benign 0.10
R4649:Trim40 UTSW 17 36882639 splice site probably null
R4903:Trim40 UTSW 17 36883225 missense possibly damaging 0.95
R5384:Trim40 UTSW 17 36888865 missense probably damaging 0.99
R5680:Trim40 UTSW 17 36888982 missense probably damaging 0.99
R5969:Trim40 UTSW 17 36882427 missense probably benign
R6830:Trim40 UTSW 17 36888850 missense possibly damaging 0.89
R7008:Trim40 UTSW 17 36883976 missense probably damaging 1.00
R7112:Trim40 UTSW 17 36882642 missense probably null 1.00
R8288:Trim40 UTSW 17 36883318 missense probably benign 0.01
R9742:Trim40 UTSW 17 36889010 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GTGCGCTCCTAAAGACAAAG -3'
(R):5'- CACATGCATGCTCTCCTGAG -3'

Sequencing Primer
(F):5'- GTGCGCTCCTAAAGACAAAGAAATC -3'
(R):5'- CACAAGTGTGCATGCATGTG -3'
Posted On 2019-06-26