Incidental Mutation 'R7284:Stat1'
ID565839
Institutional Source Beutler Lab
Gene Symbol Stat1
Ensembl Gene ENSMUSG00000026104
Gene Namesignal transducer and activator of transcription 1
Synonyms2010005J02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7284 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location52119440-52161865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52148922 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 495 (N495S)
Ref Sequence ENSEMBL: ENSMUSP00000141132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070968] [ENSMUST00000186057] [ENSMUST00000186574] [ENSMUST00000186857] [ENSMUST00000189244] [ENSMUST00000189347] [ENSMUST00000191435]
Predicted Effect probably benign
Transcript: ENSMUST00000070968
AA Change: N489S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000066743
Gene: ENSMUSG00000026104
AA Change: N489S

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 139 315 1.4e-56 PFAM
Pfam:STAT_bind 317 566 4.2e-82 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 2.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186057
AA Change: N495S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000141132
Gene: ENSMUSG00000026104
AA Change: N495S

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 3.4e-65 PFAM
Pfam:STAT_bind 317 573 3.9e-118 PFAM
SH2 577 693 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 721 745 2.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186574
AA Change: N489S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000140518
Gene: ENSMUSG00000026104
AA Change: N489S

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186857
AA Change: N489S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000140875
Gene: ENSMUSG00000026104
AA Change: N489S

DomainStartEndE-ValueType
STAT_int 2 122 2.5e-61 SMART
Pfam:STAT_alpha 136 315 1.2e-64 PFAM
Pfam:STAT_bind 317 567 4.4e-121 PFAM
SH2 571 687 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 715 739 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189244
SMART Domains Protein: ENSMUSP00000140482
Gene: ENSMUSG00000026104

DomainStartEndE-ValueType
Pfam:STAT_bind 13 61 2.6e-14 PFAM
SH2 65 181 1.59e-1 SMART
Pfam:STAT1_TAZ2bind 209 233 7.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189336
Predicted Effect probably benign
Transcript: ENSMUST00000189347
AA Change: N489S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000141125
Gene: ENSMUSG00000026104
AA Change: N489S

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191435
AA Change: N489S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139746
Gene: ENSMUSG00000026104
AA Change: N489S

DomainStartEndE-ValueType
STAT_int 2 122 1.9e-65 SMART
Pfam:STAT_alpha 136 315 3.3e-62 PFAM
Pfam:STAT_bind 317 567 1.1e-118 PFAM
SH2 571 687 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. Two alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are largely unresponsive to interferon, fail to thrive, are susceptible to viral diseases and cutaneous leishmaniasis, and show excess osteoclastogenesis leading to increased bone mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,734,583 H942Q probably benign Het
2900092C05Rik G T 7: 12,512,678 E34* probably null Het
4933421I07Rik C T 7: 42,447,980 R30H probably damaging Het
AB124611 C A 9: 21,539,104 Q158K probably benign Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc9 A T 6: 142,682,917 L367Q probably damaging Het
Aftph T C 11: 20,726,812 K266E probably benign Het
Akap9 T A 5: 3,956,246 D190E probably damaging Het
Angel1 G T 12: 86,720,524 D359E probably damaging Het
Ano6 T C 15: 95,948,303 I474T probably damaging Het
Atp2c1 A T 9: 105,520,809 probably null Het
Best1 T C 19: 9,986,373 probably null Het
Bhlha9 A G 11: 76,672,666 S40G probably benign Het
Cabin1 G A 10: 75,694,834 R178C Het
Ccnb1ip1 A G 14: 50,792,279 Y109H probably damaging Het
Col14a1 T C 15: 55,518,319 S1763P probably damaging Het
Dars T C 1: 128,372,267 T327A probably benign Het
Dhx8 T C 11: 101,754,822 Y889H probably damaging Het
Dlg4 T A 11: 70,042,082 Y523* probably null Het
Dnah10 A T 5: 124,832,598 D4484V probably benign Het
Dnah9 A T 11: 65,990,476 M2591K probably damaging Het
Dock2 T C 11: 34,230,672 E1715G probably benign Het
Dym A G 18: 75,119,171 Y336C possibly damaging Het
Ezh2 A G 6: 47,544,519 M439T probably benign Het
Folr1 T G 7: 101,859,470 N83H possibly damaging Het
Ganab T C 19: 8,912,540 L656P probably damaging Het
Gmnc T C 16: 26,960,792 H161R probably benign Het
Gria4 A G 9: 4,472,017 Y491H probably damaging Het
Heatr3 T A 8: 88,156,774 C412S possibly damaging Het
Hmgcr A C 13: 96,652,665 V716G probably damaging Het
Igsf9 A G 1: 172,496,912 D799G probably damaging Het
Ikbkb T C 8: 22,668,960 T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 R355* probably null Het
Kcna7 T A 7: 45,409,228 I313N probably damaging Het
Kirrel A C 3: 87,083,387 D709E probably benign Het
Klb T A 5: 65,383,478 S971R probably benign Het
Krtap4-13 A T 11: 99,809,412 C140* probably null Het
Lacc1 A T 14: 77,030,869 L334Q probably damaging Het
Map6d1 T A 16: 20,241,025 R97* probably null Het
Mgat5b T C 11: 116,944,920 S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myh9 G A 15: 77,787,596 R432C probably damaging Het
Ncf4 A G 15: 78,260,702 T236A probably benign Het
Neb T C 2: 52,258,792 D2581G probably damaging Het
Nid1 T A 13: 13,489,090 M778K probably benign Het
Npas2 A G 1: 39,324,467 D209G probably benign Het
Nploc4 C T 11: 120,416,370 V181I possibly damaging Het
Nrcam A T 12: 44,564,034 I506F probably damaging Het
Olfr197 A G 16: 59,185,968 *172Q probably null Het
Olfr692 T A 7: 105,368,545 M73K probably damaging Het
Olfr803 T C 10: 129,691,351 N230S probably benign Het
Pask T A 1: 93,320,669 Q970L probably benign Het
Pfkfb4 T C 9: 109,011,240 I308T possibly damaging Het
Pla2g4d A T 2: 120,284,136 L38Q probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pom121l2 A G 13: 21,982,605 T349A probably damaging Het
Ppp1r13b A G 12: 111,834,966 I551T possibly damaging Het
Prps1l1 A G 12: 34,985,318 N144S possibly damaging Het
Prss56 A G 1: 87,185,401 N179S probably null Het
Prune2 T C 19: 17,119,886 L918P probably damaging Het
Ptprz1 C T 6: 23,000,098 T729I probably damaging Het
Rrp7a T C 15: 83,121,870 T60A probably damaging Het
Snx27 A G 3: 94,524,191 Y299H probably damaging Het
Spaca3 G T 11: 80,864,021 R96L possibly damaging Het
Tas2r130 T C 6: 131,630,307 N175S probably benign Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tdrd12 C A 7: 35,480,136 probably null Het
Thbs1 A G 2: 118,119,356 N604S probably damaging Het
Togaram1 T C 12: 65,008,680 F1482L probably benign Het
Trhr2 A T 8: 122,360,375 S109T probably damaging Het
Trpc3 A T 3: 36,624,413 M841K probably damaging Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Xirp2 T A 2: 67,516,829 M3138K probably benign Het
Zdhhc4 G A 5: 143,321,891 T125I probably benign Het
Zfp239 T A 6: 117,871,755 C151* probably null Het
Zfp473 C T 7: 44,733,203 E569K not run Het
Zzef1 T A 11: 72,886,690 D1782E probably damaging Het
Other mutations in Stat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Stat1 APN 1 52122595 start codon destroyed probably null 0.50
IGL01111:Stat1 APN 1 52142961 critical splice donor site probably null
IGL01451:Stat1 APN 1 52139343 missense probably damaging 1.00
IGL01469:Stat1 APN 1 52147370 missense possibly damaging 0.87
IGL01758:Stat1 APN 1 52136921 missense probably damaging 1.00
IGL01818:Stat1 APN 1 52151278 missense probably damaging 1.00
IGL01913:Stat1 APN 1 52126557 missense probably benign 0.08
IGL01914:Stat1 APN 1 52126557 missense probably benign 0.08
IGL02304:Stat1 APN 1 52132544 missense probably benign
IGL02428:Stat1 APN 1 52142966 splice site probably benign
baroque UTSW 1 52144209 missense probably damaging 1.00
domino UTSW 1 52140588 missense probably damaging 1.00
poison UTSW 1 52151225 splice site probably benign
roccoco UTSW 1 52123209 missense probably damaging 1.00
rollo UTSW 1 52153923 nonsense probably null
special UTSW 1 52139264 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0022:Stat1 UTSW 1 52140630 missense probably damaging 1.00
R0039:Stat1 UTSW 1 52140660 missense probably damaging 0.99
R0458:Stat1 UTSW 1 52149052 splice site probably benign
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R1313:Stat1 UTSW 1 52156006 missense probably damaging 0.98
R2998:Stat1 UTSW 1 52151249 missense probably benign 0.01
R4464:Stat1 UTSW 1 52137416 missense possibly damaging 0.52
R4709:Stat1 UTSW 1 52126521 missense probably damaging 0.97
R4934:Stat1 UTSW 1 52153923 nonsense probably null
R5038:Stat1 UTSW 1 52123209 missense probably damaging 1.00
R5075:Stat1 UTSW 1 52122712 missense possibly damaging 0.73
R5223:Stat1 UTSW 1 52144242 missense probably damaging 1.00
R5600:Stat1 UTSW 1 52148942 missense probably benign 0.06
R5866:Stat1 UTSW 1 52139264 missense probably damaging 1.00
R7105:Stat1 UTSW 1 52151249 missense probably benign 0.01
R7192:Stat1 UTSW 1 52135621 missense possibly damaging 0.65
R7309:Stat1 UTSW 1 52126621 splice site probably null
R7491:Stat1 UTSW 1 52152371 missense probably benign 0.31
R7680:Stat1 UTSW 1 52144209 missense probably damaging 1.00
R7825:Stat1 UTSW 1 52151308 missense probably damaging 0.98
R7915:Stat1 UTSW 1 52151281 missense probably benign 0.17
R8245:Stat1 UTSW 1 52155019 missense probably benign 0.01
R8309:Stat1 UTSW 1 52151245 missense possibly damaging 0.51
RF036:Stat1 UTSW 1 52152260 missense probably benign
RF060:Stat1 UTSW 1 52152260 missense probably benign
X0027:Stat1 UTSW 1 52139271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAGCGTGAACCTGCTAA -3'
(R):5'- ACTTGGCTACAACCAGCTG -3'

Sequencing Primer
(F):5'- CAAGCGTGAACCTGCTAATTTCTGAG -3'
(R):5'- AGCACTCTTGTACCTCTAAGCATCAG -3'
Posted On2019-06-26