Incidental Mutation 'R7284:Xirp2'
ID 565846
Institutional Source Beutler Lab
Gene Symbol Xirp2
Ensembl Gene ENSMUSG00000027022
Gene Name xin actin-binding repeat containing 2
Synonyms 2310003D02Rik, 2310008C07Rik, myomaxin, Cmya3, A530024P18Rik, mXin beta
MMRRC Submission
Accession Numbers

Genbank: NM_001024618, NM_001083919; MGI: 2685198
Is this an essential gene? Possibly non essential (E-score: 0.468) question?
Stock # R7284 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 67446002-67526614 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 67516829 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 3138 (M3138K)
Ref Sequence ENSEMBL: ENSMUSP00000028410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028410
AA Change: M3138K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: M3138K

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4e-9 PFAM
Pfam:Xin 384 398 7.6e-10 PFAM
Pfam:Xin 420 435 6.4e-9 PFAM
Pfam:Xin 458 473 5.3e-9 PFAM
Pfam:Xin 536 551 4.1e-12 PFAM
Pfam:Xin 574 588 2.1e-8 PFAM
Pfam:Xin 609 623 6e-9 PFAM
Pfam:Xin 642 656 5.6e-8 PFAM
Pfam:Xin 679 693 5.9e-8 PFAM
Pfam:Xin 784 799 1.1e-10 PFAM
Pfam:Xin 822 837 3.9e-11 PFAM
Pfam:Xin 861 875 8.6e-12 PFAM
Pfam:Xin 894 909 2.8e-10 PFAM
Pfam:Xin 1006 1021 3.1e-9 PFAM
Pfam:Xin 1079 1094 6.7e-10 PFAM
Pfam:Xin 1117 1132 1.5e-10 PFAM
Pfam:Xin 1154 1169 2.4e-8 PFAM
Pfam:Xin 1256 1271 4.6e-8 PFAM
Pfam:Xin 1292 1305 1.6e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
LIM 3256 3308 4.45e-12 SMART
low complexity region 3356 3367 N/A INTRINSIC
low complexity region 3549 3565 N/A INTRINSIC
low complexity region 3614 3625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112347
AA Change: M3138K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022
AA Change: M3138K

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4.3e-8 PFAM
Pfam:Xin 383 398 6.9e-9 PFAM
Pfam:Xin 420 435 1.8e-8 PFAM
Pfam:Xin 458 473 6.9e-8 PFAM
Pfam:Xin 536 551 2.8e-10 PFAM
Pfam:Xin 608 623 2.4e-8 PFAM
Pfam:Xin 642 657 1.7e-7 PFAM
Pfam:Xin 784 799 3.5e-9 PFAM
Pfam:Xin 822 837 8.9e-10 PFAM
Pfam:Xin 861 876 3.9e-10 PFAM
Pfam:Xin 894 909 5.4e-9 PFAM
Pfam:Xin 1006 1021 6.2e-8 PFAM
Pfam:Xin 1079 1094 2.4e-8 PFAM
Pfam:Xin 1117 1132 9.5e-9 PFAM
Pfam:Xin 1291 1306 5.8e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype Strain: 4947971; 4453315
Lethality: D3-D21
PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,734,583 H942Q probably benign Het
2900092C05Rik G T 7: 12,512,678 E34* probably null Het
4933421I07Rik C T 7: 42,447,980 R30H probably damaging Het
AB124611 C A 9: 21,539,104 Q158K probably benign Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc9 A T 6: 142,682,917 L367Q probably damaging Het
Aftph T C 11: 20,726,812 K266E probably benign Het
Akap9 T A 5: 3,956,246 D190E probably damaging Het
Angel1 G T 12: 86,720,524 D359E probably damaging Het
Ano6 T C 15: 95,948,303 I474T probably damaging Het
Atp2c1 A T 9: 105,520,809 probably null Het
Best1 T C 19: 9,986,373 probably null Het
Bhlha9 A G 11: 76,672,666 S40G probably benign Het
Cabin1 G A 10: 75,694,834 R178C Het
Ccnb1ip1 A G 14: 50,792,279 Y109H probably damaging Het
Col14a1 T C 15: 55,518,319 S1763P probably damaging Het
Dars T C 1: 128,372,267 T327A probably benign Het
Dhx8 T C 11: 101,754,822 Y889H probably damaging Het
Dlg4 T A 11: 70,042,082 Y523* probably null Het
Dnah10 A T 5: 124,832,598 D4484V probably benign Het
Dnah9 A T 11: 65,990,476 M2591K probably damaging Het
Dock2 T C 11: 34,230,672 E1715G probably benign Het
Dym A G 18: 75,119,171 Y336C possibly damaging Het
Ezh2 A G 6: 47,544,519 M439T probably benign Het
Folr1 T G 7: 101,859,470 N83H possibly damaging Het
Ganab T C 19: 8,912,540 L656P probably damaging Het
Gmnc T C 16: 26,960,792 H161R probably benign Het
Gria4 A G 9: 4,472,017 Y491H probably damaging Het
Heatr3 T A 8: 88,156,774 C412S possibly damaging Het
Hmgcr A C 13: 96,652,665 V716G probably damaging Het
Igsf9 A G 1: 172,496,912 D799G probably damaging Het
Ikbkb T C 8: 22,668,960 T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 R355* probably null Het
Kcna7 T A 7: 45,409,228 I313N probably damaging Het
Kirrel A C 3: 87,083,387 D709E probably benign Het
Klb T A 5: 65,383,478 S971R probably benign Het
Krtap4-13 A T 11: 99,809,412 C140* probably null Het
Lacc1 A T 14: 77,030,869 L334Q probably damaging Het
Map6d1 T A 16: 20,241,025 R97* probably null Het
Mgat5b T C 11: 116,944,920 S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myh9 G A 15: 77,787,596 R432C probably damaging Het
Ncf4 A G 15: 78,260,702 T236A probably benign Het
Neb T C 2: 52,258,792 D2581G probably damaging Het
Nid1 T A 13: 13,489,090 M778K probably benign Het
Npas2 A G 1: 39,324,467 D209G probably benign Het
Nploc4 C T 11: 120,416,370 V181I possibly damaging Het
Nrcam A T 12: 44,564,034 I506F probably damaging Het
Olfr197 A G 16: 59,185,968 *172Q probably null Het
Olfr692 T A 7: 105,368,545 M73K probably damaging Het
Olfr803 T C 10: 129,691,351 N230S probably benign Het
Pask T A 1: 93,320,669 Q970L probably benign Het
Pfkfb4 T C 9: 109,011,240 I308T possibly damaging Het
Pla2g4d A T 2: 120,284,136 L38Q probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pom121l2 A G 13: 21,982,605 T349A probably damaging Het
Ppp1r13b A G 12: 111,834,966 I551T possibly damaging Het
Prps1l1 A G 12: 34,985,318 N144S possibly damaging Het
Prss56 A G 1: 87,185,401 N179S probably null Het
Prune2 T C 19: 17,119,886 L918P probably damaging Het
Ptprz1 C T 6: 23,000,098 T729I probably damaging Het
Rrp7a T C 15: 83,121,870 T60A probably damaging Het
Snx27 A G 3: 94,524,191 Y299H probably damaging Het
Spaca3 G T 11: 80,864,021 R96L possibly damaging Het
Stat1 A G 1: 52,148,922 N495S probably benign Het
Tas2r130 T C 6: 131,630,307 N175S probably benign Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tdrd12 C A 7: 35,480,136 probably null Het
Thbs1 A G 2: 118,119,356 N604S probably damaging Het
Togaram1 T C 12: 65,008,680 F1482L probably benign Het
Trhr2 A T 8: 122,360,375 S109T probably damaging Het
Trpc3 A T 3: 36,624,413 M841K probably damaging Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Zdhhc4 G A 5: 143,321,891 T125I probably benign Het
Zfp239 T A 6: 117,871,755 C151* probably null Het
Zfp473 C T 7: 44,733,203 E569K not run Het
Zzef1 T A 11: 72,886,690 D1782E probably damaging Het
Other mutations in Xirp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Xirp2 APN 2 67513375 missense probably benign 0.37
IGL00336:Xirp2 APN 2 67512598 missense possibly damaging 0.93
IGL00596:Xirp2 APN 2 67514882 missense probably benign 0.08
IGL00862:Xirp2 APN 2 67516903 missense probably benign 0.00
IGL01124:Xirp2 APN 2 67508615 missense probably damaging 0.99
IGL01289:Xirp2 APN 2 67513181 missense probably damaging 0.99
IGL01293:Xirp2 APN 2 67515184 missense possibly damaging 0.51
IGL01372:Xirp2 APN 2 67513990 missense possibly damaging 0.93
IGL01385:Xirp2 APN 2 67509677 missense probably damaging 0.99
IGL01411:Xirp2 APN 2 67514083 missense probably benign 0.00
IGL01413:Xirp2 APN 2 67509926 missense probably damaging 1.00
IGL01551:Xirp2 APN 2 67513505 missense probably benign
IGL01672:Xirp2 APN 2 67508502 missense probably benign
IGL01724:Xirp2 APN 2 67526067 missense probably benign
IGL01739:Xirp2 APN 2 67515138 missense probably benign 0.15
IGL01807:Xirp2 APN 2 67515031 missense probably benign
IGL02006:Xirp2 APN 2 67511962 missense possibly damaging 0.85
IGL02030:Xirp2 APN 2 67508981 missense probably benign 0.06
IGL02066:Xirp2 APN 2 67526071 missense probably benign
IGL02138:Xirp2 APN 2 67516956 missense probably benign 0.15
IGL02250:Xirp2 APN 2 67514012 missense probably benign 0.03
IGL02265:Xirp2 APN 2 67517150 missense possibly damaging 0.94
IGL02274:Xirp2 APN 2 67508651 missense probably benign 0.12
IGL02322:Xirp2 APN 2 67508738 missense probably benign 0.00
IGL02327:Xirp2 APN 2 67510100 missense probably damaging 1.00
IGL02378:Xirp2 APN 2 67513768 missense probably benign 0.00
IGL02492:Xirp2 APN 2 67516167 missense probably damaging 0.99
IGL02549:Xirp2 APN 2 67513102 missense probably benign 0.03
IGL02578:Xirp2 APN 2 67511247 missense probably damaging 0.96
IGL02635:Xirp2 APN 2 67507910 missense possibly damaging 0.86
IGL02654:Xirp2 APN 2 67514671 missense possibly damaging 0.86
IGL02663:Xirp2 APN 2 67509458 missense possibly damaging 0.92
IGL02795:Xirp2 APN 2 67509136 missense probably damaging 1.00
IGL02934:Xirp2 APN 2 67515676 missense probably benign 0.33
IGL03003:Xirp2 APN 2 67515562 missense possibly damaging 0.93
IGL03069:Xirp2 APN 2 67509532 missense possibly damaging 0.91
IGL03286:Xirp2 APN 2 67516310 missense probably damaging 0.99
IGL03326:Xirp2 APN 2 67482246 missense probably benign 0.01
IGL03381:Xirp2 APN 2 67514226 missense probably benign 0.34
IGL03394:Xirp2 APN 2 67515194 missense probably damaging 0.99
Ordovician UTSW 2 67482363 missense possibly damaging 0.72
silurian UTSW 2 67519265 missense probably damaging 0.99
3-1:Xirp2 UTSW 2 67508198 missense possibly damaging 0.95
H8562:Xirp2 UTSW 2 67515457 missense probably benign
PIT4142001:Xirp2 UTSW 2 67519362 splice site probably benign
PIT4260001:Xirp2 UTSW 2 67511597 missense possibly damaging 0.96
PIT4445001:Xirp2 UTSW 2 67509772 missense possibly damaging 0.84
PIT4531001:Xirp2 UTSW 2 67515482 missense possibly damaging 0.73
R0015:Xirp2 UTSW 2 67510899 nonsense probably null
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0063:Xirp2 UTSW 2 67509083 missense probably damaging 0.99
R0066:Xirp2 UTSW 2 67512140 missense possibly damaging 0.85
R0109:Xirp2 UTSW 2 67519278 missense probably damaging 1.00
R0111:Xirp2 UTSW 2 67508378 missense probably damaging 0.99
R0115:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0117:Xirp2 UTSW 2 67517120 missense possibly damaging 0.94
R0133:Xirp2 UTSW 2 67517124 missense probably benign
R0282:Xirp2 UTSW 2 67513380 missense probably damaging 0.96
R0463:Xirp2 UTSW 2 67514918 missense probably benign 0.02
R0481:Xirp2 UTSW 2 67509909 missense possibly damaging 0.92
R0488:Xirp2 UTSW 2 67514821 missense possibly damaging 0.90
R0548:Xirp2 UTSW 2 67514414 missense probably benign 0.00
R0557:Xirp2 UTSW 2 67516351 missense probably benign 0.33
R0582:Xirp2 UTSW 2 67508866 missense probably benign
R0723:Xirp2 UTSW 2 67512215 missense probably damaging 0.98
R0835:Xirp2 UTSW 2 67507910 missense possibly damaging 0.86
R1160:Xirp2 UTSW 2 67509887 missense possibly damaging 0.92
R1189:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R1474:Xirp2 UTSW 2 67525067 missense probably benign 0.00
R1513:Xirp2 UTSW 2 67511530 missense probably benign 0.00
R1514:Xirp2 UTSW 2 67514323 nonsense probably null
R1519:Xirp2 UTSW 2 67515679 missense probably benign 0.44
R1532:Xirp2 UTSW 2 67513939 missense probably benign 0.00
R1537:Xirp2 UTSW 2 67510013 missense probably damaging 0.98
R1541:Xirp2 UTSW 2 67512290 missense possibly damaging 0.70
R1543:Xirp2 UTSW 2 67508039 missense probably benign
R1607:Xirp2 UTSW 2 67510295 nonsense probably null
R1620:Xirp2 UTSW 2 67510835 missense probably damaging 0.98
R1709:Xirp2 UTSW 2 67509871 missense probably benign 0.33
R1713:Xirp2 UTSW 2 67512418 missense probably benign 0.25
R1828:Xirp2 UTSW 2 67515238 missense possibly damaging 0.86
R1834:Xirp2 UTSW 2 67511140 missense probably damaging 0.99
R1905:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1907:Xirp2 UTSW 2 67516356 missense probably damaging 0.98
R1943:Xirp2 UTSW 2 67512615 missense probably benign 0.34
R1971:Xirp2 UTSW 2 67511695 missense possibly damaging 0.48
R1998:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R2075:Xirp2 UTSW 2 67510201 missense probably benign 0.33
R2132:Xirp2 UTSW 2 67508048 missense possibly damaging 0.72
R2175:Xirp2 UTSW 2 67509914 missense probably damaging 0.99
R2310:Xirp2 UTSW 2 67526247 missense probably benign 0.19
R2338:Xirp2 UTSW 2 67510770 missense probably damaging 0.98
R2426:Xirp2 UTSW 2 67514471 missense probably benign 0.02
R2483:Xirp2 UTSW 2 67524992 missense probably benign
R3084:Xirp2 UTSW 2 67509049 missense probably damaging 0.97
R3113:Xirp2 UTSW 2 67510147 missense probably benign 0.33
R3903:Xirp2 UTSW 2 67508036 missense probably benign 0.40
R3916:Xirp2 UTSW 2 67511422 missense probably benign 0.25
R3928:Xirp2 UTSW 2 67511669 missense possibly damaging 0.85
R4025:Xirp2 UTSW 2 67511402 missense probably benign 0.12
R4135:Xirp2 UTSW 2 67525397 missense probably benign 0.00
R4223:Xirp2 UTSW 2 67516493 missense possibly damaging 0.66
R4257:Xirp2 UTSW 2 67516039 missense probably benign 0.31
R4499:Xirp2 UTSW 2 67513438 missense probably benign 0.08
R4577:Xirp2 UTSW 2 67513897 missense probably damaging 0.99
R4739:Xirp2 UTSW 2 67519265 missense probably damaging 0.99
R4758:Xirp2 UTSW 2 67516535 missense probably damaging 0.98
R4834:Xirp2 UTSW 2 67516406 missense probably benign 0.26
R4855:Xirp2 UTSW 2 67511064 missense possibly damaging 0.96
R4923:Xirp2 UTSW 2 67512893 missense probably benign
R4936:Xirp2 UTSW 2 67509819 missense possibly damaging 0.85
R5032:Xirp2 UTSW 2 67525670 missense possibly damaging 0.84
R5049:Xirp2 UTSW 2 67517134 missense probably benign 0.03
R5077:Xirp2 UTSW 2 67514477 missense probably benign
R5090:Xirp2 UTSW 2 67525470 missense possibly damaging 0.83
R5107:Xirp2 UTSW 2 67509710 missense probably damaging 0.99
R5107:Xirp2 UTSW 2 67511861 missense probably damaging 1.00
R5187:Xirp2 UTSW 2 67515367 missense probably benign 0.01
R5241:Xirp2 UTSW 2 67482360 nonsense probably null
R5307:Xirp2 UTSW 2 67511162 missense probably damaging 0.99
R5342:Xirp2 UTSW 2 67513461 missense probably damaging 0.96
R5370:Xirp2 UTSW 2 67512152 missense possibly damaging 0.72
R5375:Xirp2 UTSW 2 67511906 missense probably damaging 0.99
R5407:Xirp2 UTSW 2 67510969 missense probably benign 0.33
R5514:Xirp2 UTSW 2 67505121 missense probably benign 0.03
R5531:Xirp2 UTSW 2 67515302 missense probably benign 0.42
R5590:Xirp2 UTSW 2 67514035 missense probably benign 0.23
R5646:Xirp2 UTSW 2 67510790 missense probably damaging 0.99
R5649:Xirp2 UTSW 2 67516895 missense probably benign 0.00
R5686:Xirp2 UTSW 2 67482298 missense probably damaging 0.99
R5761:Xirp2 UTSW 2 67510967 missense probably benign 0.00
R5777:Xirp2 UTSW 2 67510004 missense possibly damaging 0.92
R5785:Xirp2 UTSW 2 67509662 missense probably damaging 0.96
R5843:Xirp2 UTSW 2 67476785 start gained probably benign
R5846:Xirp2 UTSW 2 67509243 missense probably damaging 0.98
R5875:Xirp2 UTSW 2 67505080 missense probably benign 0.00
R5896:Xirp2 UTSW 2 67508698 missense probably benign 0.32
R5896:Xirp2 UTSW 2 67509946 missense possibly damaging 0.91
R5901:Xirp2 UTSW 2 67513066 missense possibly damaging 0.91
R5934:Xirp2 UTSW 2 67524804 missense possibly damaging 0.92
R5950:Xirp2 UTSW 2 67511320 missense possibly damaging 0.95
R5996:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6013:Xirp2 UTSW 2 67510943 missense possibly damaging 0.48
R6048:Xirp2 UTSW 2 67508243 missense possibly damaging 0.96
R6111:Xirp2 UTSW 2 67511817 missense possibly damaging 0.86
R6180:Xirp2 UTSW 2 67505577 critical splice donor site probably null
R6342:Xirp2 UTSW 2 67511650 missense possibly damaging 0.91
R6346:Xirp2 UTSW 2 67516081 missense probably benign 0.00
R6603:Xirp2 UTSW 2 67516544 missense probably benign
R6604:Xirp2 UTSW 2 67509845 missense possibly damaging 0.86
R6669:Xirp2 UTSW 2 67513355 missense possibly damaging 0.78
R6701:Xirp2 UTSW 2 67516225 missense possibly damaging 0.94
R6726:Xirp2 UTSW 2 67512868 missense possibly damaging 0.88
R6833:Xirp2 UTSW 2 67509950 missense probably benign 0.12
R6897:Xirp2 UTSW 2 67508567 missense probably damaging 1.00
R6933:Xirp2 UTSW 2 67514857 missense probably benign 0.34
R7020:Xirp2 UTSW 2 67525569 missense probably benign
R7042:Xirp2 UTSW 2 67513289 missense probably benign 0.12
R7060:Xirp2 UTSW 2 67515608 missense probably damaging 1.00
R7179:Xirp2 UTSW 2 67509833 missense probably benign 0.00
R7229:Xirp2 UTSW 2 67525551 missense probably damaging 0.99
R7253:Xirp2 UTSW 2 67513482 missense probably benign
R7450:Xirp2 UTSW 2 67509815 missense possibly damaging 0.86
R7476:Xirp2 UTSW 2 67510634 missense probably benign 0.01
R7489:Xirp2 UTSW 2 67525560 missense possibly damaging 0.83
R7513:Xirp2 UTSW 2 67510764 missense possibly damaging 0.86
R7549:Xirp2 UTSW 2 67508897 missense possibly damaging 0.91
R7563:Xirp2 UTSW 2 67509901 missense probably damaging 0.99
R7567:Xirp2 UTSW 2 67515982 missense probably benign 0.02
R7577:Xirp2 UTSW 2 67514965 missense possibly damaging 0.65
R7597:Xirp2 UTSW 2 67525755 missense possibly damaging 0.84
R7610:Xirp2 UTSW 2 67525962 missense possibly damaging 0.92
R7613:Xirp2 UTSW 2 67514498 missense probably benign 0.00
R7669:Xirp2 UTSW 2 67512177 missense probably benign 0.00
R7670:Xirp2 UTSW 2 67510573 missense possibly damaging 0.91
R7673:Xirp2 UTSW 2 67517087 missense probably damaging 1.00
R7682:Xirp2 UTSW 2 67508849 missense probably damaging 0.99
R7755:Xirp2 UTSW 2 67515182 missense probably benign
R7805:Xirp2 UTSW 2 67509981 missense probably benign 0.23
R7815:Xirp2 UTSW 2 67509412 missense probably damaging 1.00
R7823:Xirp2 UTSW 2 67511774 missense probably damaging 1.00
R7842:Xirp2 UTSW 2 67524945 missense probably benign 0.00
R7863:Xirp2 UTSW 2 67512730 missense probably benign 0.03
R7895:Xirp2 UTSW 2 67509497 missense probably damaging 0.96
R7948:Xirp2 UTSW 2 67519314 missense possibly damaging 0.95
R8083:Xirp2 UTSW 2 67508699 missense possibly damaging 0.71
R8125:Xirp2 UTSW 2 67512035 missense probably benign 0.25
R8154:Xirp2 UTSW 2 67511673 missense possibly damaging 0.48
R8169:Xirp2 UTSW 2 67513199 missense probably benign 0.00
R8213:Xirp2 UTSW 2 67476866 missense probably damaging 0.96
R8215:Xirp2 UTSW 2 67516509 missense probably benign 0.08
R8230:Xirp2 UTSW 2 67515665 missense probably damaging 0.99
R8266:Xirp2 UTSW 2 67508574 missense probably damaging 0.98
R8350:Xirp2 UTSW 2 67525369 missense probably benign
R8432:Xirp2 UTSW 2 67510618 missense probably benign
R8441:Xirp2 UTSW 2 67512815 missense possibly damaging 0.85
R8677:Xirp2 UTSW 2 67516634 missense probably damaging 0.98
R8773:Xirp2 UTSW 2 67525183 missense probably benign
R8794:Xirp2 UTSW 2 67511213 missense probably damaging 0.98
R8930:Xirp2 UTSW 2 67482363 missense possibly damaging 0.72
R8932:Xirp2 UTSW 2 67482363 missense possibly damaging 0.72
R8939:Xirp2 UTSW 2 67516144 missense probably benign 0.04
R9263:Xirp2 UTSW 2 67514945 missense possibly damaging 0.76
R9313:Xirp2 UTSW 2 67516978 missense probably damaging 0.99
R9350:Xirp2 UTSW 2 67519309 missense probably damaging 1.00
R9375:Xirp2 UTSW 2 67511774 missense probably damaging 1.00
R9442:Xirp2 UTSW 2 67511891 nonsense probably null
R9447:Xirp2 UTSW 2 67508606 missense probably damaging 0.98
R9457:Xirp2 UTSW 2 67515632 missense probably benign 0.03
R9507:Xirp2 UTSW 2 67513936 missense possibly damaging 0.95
R9529:Xirp2 UTSW 2 67525196 missense possibly damaging 0.93
R9569:Xirp2 UTSW 2 67510898 missense probably damaging 1.00
R9607:Xirp2 UTSW 2 67510762 missense possibly damaging 0.72
R9648:Xirp2 UTSW 2 67516255 missense probably benign
R9651:Xirp2 UTSW 2 67513823 missense possibly damaging 0.72
R9678:Xirp2 UTSW 2 67509444 missense possibly damaging 0.91
R9691:Xirp2 UTSW 2 67510195 missense possibly damaging 0.91
R9777:Xirp2 UTSW 2 67517035 missense possibly damaging 0.85
RF035:Xirp2 UTSW 2 67525544 utr 3 prime probably benign
RF040:Xirp2 UTSW 2 67525544 utr 3 prime probably benign
X0063:Xirp2 UTSW 2 67516123 missense probably benign 0.04
X0065:Xirp2 UTSW 2 67515118 missense probably benign 0.34
Z1088:Xirp2 UTSW 2 67513321 missense probably benign 0.03
Z1176:Xirp2 UTSW 2 67511393 missense probably damaging 0.99
Z1176:Xirp2 UTSW 2 67514579 missense probably benign 0.17
Z1176:Xirp2 UTSW 2 67525232 missense probably damaging 1.00
Z1177:Xirp2 UTSW 2 67510193 frame shift probably null
Z1177:Xirp2 UTSW 2 67525371 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAACGTTTTCTGAATGGCCATG -3'
(R):5'- GACATCTTCATAGGTCGGTGG -3'

Sequencing Primer
(F):5'- GGGAATTTGAGAATGACCCAGTTTTC -3'
(R):5'- GGGCATGCTTGAAGTCAAAGCC -3'
Posted On 2019-06-26