Incidental Mutation 'R7284:Xirp2'
ID 565846
Institutional Source Beutler Lab
Gene Symbol Xirp2
Ensembl Gene ENSMUSG00000027022
Gene Name xin actin-binding repeat containing 2
Synonyms mXin beta, 2310008C07Rik, 2310003D02Rik, Cmya3, myomaxin, A530024P18Rik
MMRRC Submission 045392-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.321) question?
Stock # R7284 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 67276343-67356964 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 67347173 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 3138 (M3138K)
Ref Sequence ENSEMBL: ENSMUSP00000028410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028410] [ENSMUST00000112347]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028410
AA Change: M3138K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028410
Gene: ENSMUSG00000027022
AA Change: M3138K

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4e-9 PFAM
Pfam:Xin 384 398 7.6e-10 PFAM
Pfam:Xin 420 435 6.4e-9 PFAM
Pfam:Xin 458 473 5.3e-9 PFAM
Pfam:Xin 536 551 4.1e-12 PFAM
Pfam:Xin 574 588 2.1e-8 PFAM
Pfam:Xin 609 623 6e-9 PFAM
Pfam:Xin 642 656 5.6e-8 PFAM
Pfam:Xin 679 693 5.9e-8 PFAM
Pfam:Xin 784 799 1.1e-10 PFAM
Pfam:Xin 822 837 3.9e-11 PFAM
Pfam:Xin 861 875 8.6e-12 PFAM
Pfam:Xin 894 909 2.8e-10 PFAM
Pfam:Xin 1006 1021 3.1e-9 PFAM
Pfam:Xin 1079 1094 6.7e-10 PFAM
Pfam:Xin 1117 1132 1.5e-10 PFAM
Pfam:Xin 1154 1169 2.4e-8 PFAM
Pfam:Xin 1256 1271 4.6e-8 PFAM
Pfam:Xin 1292 1305 1.6e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
LIM 3256 3308 4.45e-12 SMART
low complexity region 3356 3367 N/A INTRINSIC
low complexity region 3549 3565 N/A INTRINSIC
low complexity region 3614 3625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112347
AA Change: M3138K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107966
Gene: ENSMUSG00000027022
AA Change: M3138K

DomainStartEndE-ValueType
low complexity region 176 188 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
Pfam:Xin 343 358 4.3e-8 PFAM
Pfam:Xin 383 398 6.9e-9 PFAM
Pfam:Xin 420 435 1.8e-8 PFAM
Pfam:Xin 458 473 6.9e-8 PFAM
Pfam:Xin 536 551 2.8e-10 PFAM
Pfam:Xin 608 623 2.4e-8 PFAM
Pfam:Xin 642 657 1.7e-7 PFAM
Pfam:Xin 784 799 3.5e-9 PFAM
Pfam:Xin 822 837 8.9e-10 PFAM
Pfam:Xin 861 876 3.9e-10 PFAM
Pfam:Xin 894 909 5.4e-9 PFAM
Pfam:Xin 1006 1021 6.2e-8 PFAM
Pfam:Xin 1079 1094 2.4e-8 PFAM
Pfam:Xin 1117 1132 9.5e-9 PFAM
Pfam:Xin 1291 1306 5.8e-8 PFAM
low complexity region 1314 1325 N/A INTRINSIC
low complexity region 1547 1559 N/A INTRINSIC
coiled coil region 1683 1704 N/A INTRINSIC
low complexity region 1862 1871 N/A INTRINSIC
low complexity region 2031 2043 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2087 2093 N/A INTRINSIC
low complexity region 2105 2123 N/A INTRINSIC
low complexity region 2159 2177 N/A INTRINSIC
coiled coil region 2288 2311 N/A INTRINSIC
coiled coil region 2738 2767 N/A INTRINSIC
low complexity region 2794 2804 N/A INTRINSIC
low complexity region 2906 2919 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype PHENOTYPE: Homozygous null mice have an abnormal heart shape, ventricular septal defects, a failure of mature intercalated disc formation, severe growth retardation, and postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G T 7: 12,246,605 (GRCm39) E34* probably null Het
4933421I07Rik C T 7: 42,097,404 (GRCm39) R30H probably damaging Het
AB124611 C A 9: 21,450,400 (GRCm39) Q158K probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abcc9 A T 6: 142,628,643 (GRCm39) L367Q probably damaging Het
Aftph T C 11: 20,676,812 (GRCm39) K266E probably benign Het
Akap9 T A 5: 4,006,246 (GRCm39) D190E probably damaging Het
Angel1 G T 12: 86,767,298 (GRCm39) D359E probably damaging Het
Ano6 T C 15: 95,846,184 (GRCm39) I474T probably damaging Het
Atp2c1 A T 9: 105,398,008 (GRCm39) probably null Het
Best1 T C 19: 9,963,737 (GRCm39) probably null Het
Bhlha9 A G 11: 76,563,492 (GRCm39) S40G probably benign Het
Cabin1 G A 10: 75,530,668 (GRCm39) R178C Het
Ccnb1ip1 A G 14: 51,029,736 (GRCm39) Y109H probably damaging Het
Col14a1 T C 15: 55,381,715 (GRCm39) S1763P probably damaging Het
Dars1 T C 1: 128,300,004 (GRCm39) T327A probably benign Het
Dhx8 T C 11: 101,645,648 (GRCm39) Y889H probably damaging Het
Dlg4 T A 11: 69,932,908 (GRCm39) Y523* probably null Het
Dnah10 A T 5: 124,909,662 (GRCm39) D4484V probably benign Het
Dnah9 A T 11: 65,881,302 (GRCm39) M2591K probably damaging Het
Dock2 T C 11: 34,180,672 (GRCm39) E1715G probably benign Het
Dym A G 18: 75,252,242 (GRCm39) Y336C possibly damaging Het
Ezh2 A G 6: 47,521,453 (GRCm39) M439T probably benign Het
Folr1 T G 7: 101,508,677 (GRCm39) N83H possibly damaging Het
Ganab T C 19: 8,889,904 (GRCm39) L656P probably damaging Het
Gmnc T C 16: 26,779,542 (GRCm39) H161R probably benign Het
Gria4 A G 9: 4,472,017 (GRCm39) Y491H probably damaging Het
Heatr3 T A 8: 88,883,402 (GRCm39) C412S possibly damaging Het
Hmgcr A C 13: 96,789,173 (GRCm39) V716G probably damaging Het
Igsf9 A G 1: 172,324,479 (GRCm39) D799G probably damaging Het
Ikbkb T C 8: 23,158,976 (GRCm39) T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 (GRCm39) R355* probably null Het
Kcna7 T A 7: 45,058,652 (GRCm39) I313N probably damaging Het
Kirrel1 A C 3: 86,990,694 (GRCm39) D709E probably benign Het
Klb T A 5: 65,540,821 (GRCm39) S971R probably benign Het
Krtap4-13 A T 11: 99,700,238 (GRCm39) C140* probably null Het
Lacc1 A T 14: 77,268,309 (GRCm39) L334Q probably damaging Het
Map6d1 T A 16: 20,059,775 (GRCm39) R97* probably null Het
Mgat5b T C 11: 116,835,746 (GRCm39) S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Myh9 G A 15: 77,671,796 (GRCm39) R432C probably damaging Het
Ncf4 A G 15: 78,144,902 (GRCm39) T236A probably benign Het
Neb T C 2: 52,148,804 (GRCm39) D2581G probably damaging Het
Nid1 T A 13: 13,663,675 (GRCm39) M778K probably benign Het
Npas2 A G 1: 39,363,548 (GRCm39) D209G probably benign Het
Nploc4 C T 11: 120,307,196 (GRCm39) V181I possibly damaging Het
Nrcam A T 12: 44,610,817 (GRCm39) I506F probably damaging Het
Or52w1 T A 7: 105,017,752 (GRCm39) M73K probably damaging Het
Or5h27 A G 16: 59,006,331 (GRCm39) *172Q probably null Het
Or6c3b T C 10: 129,527,220 (GRCm39) N230S probably benign Het
Pask T A 1: 93,248,391 (GRCm39) Q970L probably benign Het
Pfkfb4 T C 9: 108,840,308 (GRCm39) I308T possibly damaging Het
Pla2g4d A T 2: 120,114,617 (GRCm39) L38Q probably damaging Het
Pld1 A G 3: 28,185,882 (GRCm39) T1036A possibly damaging Het
Pom121l2 A G 13: 22,166,775 (GRCm39) T349A probably damaging Het
Ppp1r13b A G 12: 111,801,400 (GRCm39) I551T possibly damaging Het
Prps1l1 A G 12: 35,035,317 (GRCm39) N144S possibly damaging Het
Prss56 A G 1: 87,113,123 (GRCm39) N179S probably null Het
Prune2 T C 19: 17,097,250 (GRCm39) L918P probably damaging Het
Ptprz1 C T 6: 23,000,097 (GRCm39) T729I probably damaging Het
Relch T A 1: 105,662,308 (GRCm39) H942Q probably benign Het
Rrp7a T C 15: 83,006,071 (GRCm39) T60A probably damaging Het
Snx27 A G 3: 94,431,498 (GRCm39) Y299H probably damaging Het
Spaca3 G T 11: 80,754,847 (GRCm39) R96L possibly damaging Het
Stat1 A G 1: 52,188,081 (GRCm39) N495S probably benign Het
Tas2r130 T C 6: 131,607,270 (GRCm39) N175S probably benign Het
Tcaf2 A G 6: 42,606,472 (GRCm39) L494P probably damaging Het
Tdrd12 C A 7: 35,179,561 (GRCm39) probably null Het
Thbs1 A G 2: 117,949,837 (GRCm39) N604S probably damaging Het
Togaram1 T C 12: 65,055,454 (GRCm39) F1482L probably benign Het
Trhr2 A T 8: 123,087,114 (GRCm39) S109T probably damaging Het
Trpc3 A T 3: 36,678,562 (GRCm39) M841K probably damaging Het
Tubgcp5 C T 7: 55,473,315 (GRCm39) R798C probably benign Het
Zdhhc4 G A 5: 143,307,646 (GRCm39) T125I probably benign Het
Zfp239 T A 6: 117,848,716 (GRCm39) C151* probably null Het
Zfp473 C T 7: 44,382,627 (GRCm39) E569K not run Het
Zzef1 T A 11: 72,777,516 (GRCm39) D1782E probably damaging Het
Other mutations in Xirp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Xirp2 APN 2 67,343,719 (GRCm39) missense probably benign 0.37
IGL00336:Xirp2 APN 2 67,342,942 (GRCm39) missense possibly damaging 0.93
IGL00596:Xirp2 APN 2 67,345,226 (GRCm39) missense probably benign 0.08
IGL00862:Xirp2 APN 2 67,347,247 (GRCm39) missense probably benign 0.00
IGL01124:Xirp2 APN 2 67,338,959 (GRCm39) missense probably damaging 0.99
IGL01289:Xirp2 APN 2 67,343,525 (GRCm39) missense probably damaging 0.99
IGL01293:Xirp2 APN 2 67,345,528 (GRCm39) missense possibly damaging 0.51
IGL01372:Xirp2 APN 2 67,344,334 (GRCm39) missense possibly damaging 0.93
IGL01385:Xirp2 APN 2 67,340,021 (GRCm39) missense probably damaging 0.99
IGL01411:Xirp2 APN 2 67,344,427 (GRCm39) missense probably benign 0.00
IGL01413:Xirp2 APN 2 67,340,270 (GRCm39) missense probably damaging 1.00
IGL01551:Xirp2 APN 2 67,343,849 (GRCm39) missense probably benign
IGL01672:Xirp2 APN 2 67,338,846 (GRCm39) missense probably benign
IGL01724:Xirp2 APN 2 67,356,411 (GRCm39) missense probably benign
IGL01739:Xirp2 APN 2 67,345,482 (GRCm39) missense probably benign 0.15
IGL01807:Xirp2 APN 2 67,345,375 (GRCm39) missense probably benign
IGL02006:Xirp2 APN 2 67,342,306 (GRCm39) missense possibly damaging 0.85
IGL02030:Xirp2 APN 2 67,339,325 (GRCm39) missense probably benign 0.06
IGL02066:Xirp2 APN 2 67,356,415 (GRCm39) missense probably benign
IGL02138:Xirp2 APN 2 67,347,300 (GRCm39) missense probably benign 0.15
IGL02250:Xirp2 APN 2 67,344,356 (GRCm39) missense probably benign 0.03
IGL02265:Xirp2 APN 2 67,347,494 (GRCm39) missense possibly damaging 0.94
IGL02274:Xirp2 APN 2 67,338,995 (GRCm39) missense probably benign 0.12
IGL02322:Xirp2 APN 2 67,339,082 (GRCm39) missense probably benign 0.00
IGL02327:Xirp2 APN 2 67,340,444 (GRCm39) missense probably damaging 1.00
IGL02378:Xirp2 APN 2 67,344,112 (GRCm39) missense probably benign 0.00
IGL02492:Xirp2 APN 2 67,346,511 (GRCm39) missense probably damaging 0.99
IGL02549:Xirp2 APN 2 67,343,446 (GRCm39) missense probably benign 0.03
IGL02578:Xirp2 APN 2 67,341,591 (GRCm39) missense probably damaging 0.96
IGL02635:Xirp2 APN 2 67,338,254 (GRCm39) missense possibly damaging 0.86
IGL02654:Xirp2 APN 2 67,345,015 (GRCm39) missense possibly damaging 0.86
IGL02663:Xirp2 APN 2 67,339,802 (GRCm39) missense possibly damaging 0.92
IGL02795:Xirp2 APN 2 67,339,480 (GRCm39) missense probably damaging 1.00
IGL02934:Xirp2 APN 2 67,346,020 (GRCm39) missense probably benign 0.33
IGL03003:Xirp2 APN 2 67,345,906 (GRCm39) missense possibly damaging 0.93
IGL03069:Xirp2 APN 2 67,339,876 (GRCm39) missense possibly damaging 0.91
IGL03286:Xirp2 APN 2 67,346,654 (GRCm39) missense probably damaging 0.99
IGL03326:Xirp2 APN 2 67,312,590 (GRCm39) missense probably benign 0.01
IGL03381:Xirp2 APN 2 67,344,570 (GRCm39) missense probably benign 0.34
IGL03394:Xirp2 APN 2 67,345,538 (GRCm39) missense probably damaging 0.99
Ordovician UTSW 2 67,312,707 (GRCm39) missense possibly damaging 0.72
silurian UTSW 2 67,349,609 (GRCm39) missense probably damaging 0.99
3-1:Xirp2 UTSW 2 67,338,542 (GRCm39) missense possibly damaging 0.95
H8562:Xirp2 UTSW 2 67,345,801 (GRCm39) missense probably benign
PIT4142001:Xirp2 UTSW 2 67,349,706 (GRCm39) splice site probably benign
PIT4260001:Xirp2 UTSW 2 67,341,941 (GRCm39) missense possibly damaging 0.96
PIT4445001:Xirp2 UTSW 2 67,340,116 (GRCm39) missense possibly damaging 0.84
PIT4531001:Xirp2 UTSW 2 67,345,826 (GRCm39) missense possibly damaging 0.73
R0015:Xirp2 UTSW 2 67,341,243 (GRCm39) nonsense probably null
R0063:Xirp2 UTSW 2 67,339,427 (GRCm39) missense probably damaging 0.99
R0063:Xirp2 UTSW 2 67,339,427 (GRCm39) missense probably damaging 0.99
R0066:Xirp2 UTSW 2 67,342,484 (GRCm39) missense possibly damaging 0.85
R0109:Xirp2 UTSW 2 67,349,622 (GRCm39) missense probably damaging 1.00
R0111:Xirp2 UTSW 2 67,338,722 (GRCm39) missense probably damaging 0.99
R0115:Xirp2 UTSW 2 67,340,253 (GRCm39) missense possibly damaging 0.92
R0117:Xirp2 UTSW 2 67,347,464 (GRCm39) missense possibly damaging 0.94
R0133:Xirp2 UTSW 2 67,347,468 (GRCm39) missense probably benign
R0282:Xirp2 UTSW 2 67,343,724 (GRCm39) missense probably damaging 0.96
R0463:Xirp2 UTSW 2 67,345,262 (GRCm39) missense probably benign 0.02
R0481:Xirp2 UTSW 2 67,340,253 (GRCm39) missense possibly damaging 0.92
R0488:Xirp2 UTSW 2 67,345,165 (GRCm39) missense possibly damaging 0.90
R0548:Xirp2 UTSW 2 67,344,758 (GRCm39) missense probably benign 0.00
R0557:Xirp2 UTSW 2 67,346,695 (GRCm39) missense probably benign 0.33
R0582:Xirp2 UTSW 2 67,339,210 (GRCm39) missense probably benign
R0723:Xirp2 UTSW 2 67,342,559 (GRCm39) missense probably damaging 0.98
R0835:Xirp2 UTSW 2 67,338,254 (GRCm39) missense possibly damaging 0.86
R1160:Xirp2 UTSW 2 67,340,231 (GRCm39) missense possibly damaging 0.92
R1189:Xirp2 UTSW 2 67,343,805 (GRCm39) missense probably damaging 0.96
R1474:Xirp2 UTSW 2 67,355,411 (GRCm39) missense probably benign 0.00
R1513:Xirp2 UTSW 2 67,341,874 (GRCm39) missense probably benign 0.00
R1514:Xirp2 UTSW 2 67,344,667 (GRCm39) nonsense probably null
R1519:Xirp2 UTSW 2 67,346,023 (GRCm39) missense probably benign 0.44
R1532:Xirp2 UTSW 2 67,344,283 (GRCm39) missense probably benign 0.00
R1537:Xirp2 UTSW 2 67,340,357 (GRCm39) missense probably damaging 0.98
R1541:Xirp2 UTSW 2 67,342,634 (GRCm39) missense possibly damaging 0.70
R1543:Xirp2 UTSW 2 67,338,383 (GRCm39) missense probably benign
R1607:Xirp2 UTSW 2 67,340,639 (GRCm39) nonsense probably null
R1620:Xirp2 UTSW 2 67,341,179 (GRCm39) missense probably damaging 0.98
R1709:Xirp2 UTSW 2 67,340,215 (GRCm39) missense probably benign 0.33
R1713:Xirp2 UTSW 2 67,342,762 (GRCm39) missense probably benign 0.25
R1828:Xirp2 UTSW 2 67,345,582 (GRCm39) missense possibly damaging 0.86
R1834:Xirp2 UTSW 2 67,341,484 (GRCm39) missense probably damaging 0.99
R1905:Xirp2 UTSW 2 67,346,700 (GRCm39) missense probably damaging 0.98
R1907:Xirp2 UTSW 2 67,346,700 (GRCm39) missense probably damaging 0.98
R1943:Xirp2 UTSW 2 67,342,959 (GRCm39) missense probably benign 0.34
R1971:Xirp2 UTSW 2 67,342,039 (GRCm39) missense possibly damaging 0.48
R1998:Xirp2 UTSW 2 67,339,393 (GRCm39) missense probably damaging 0.97
R2075:Xirp2 UTSW 2 67,340,545 (GRCm39) missense probably benign 0.33
R2132:Xirp2 UTSW 2 67,338,392 (GRCm39) missense possibly damaging 0.72
R2175:Xirp2 UTSW 2 67,340,258 (GRCm39) missense probably damaging 0.99
R2310:Xirp2 UTSW 2 67,356,591 (GRCm39) missense probably benign 0.19
R2338:Xirp2 UTSW 2 67,341,114 (GRCm39) missense probably damaging 0.98
R2426:Xirp2 UTSW 2 67,344,815 (GRCm39) missense probably benign 0.02
R2483:Xirp2 UTSW 2 67,355,336 (GRCm39) missense probably benign
R3084:Xirp2 UTSW 2 67,339,393 (GRCm39) missense probably damaging 0.97
R3113:Xirp2 UTSW 2 67,340,491 (GRCm39) missense probably benign 0.33
R3903:Xirp2 UTSW 2 67,338,380 (GRCm39) missense probably benign 0.40
R3916:Xirp2 UTSW 2 67,341,766 (GRCm39) missense probably benign 0.25
R3928:Xirp2 UTSW 2 67,342,013 (GRCm39) missense possibly damaging 0.85
R4025:Xirp2 UTSW 2 67,341,746 (GRCm39) missense probably benign 0.12
R4135:Xirp2 UTSW 2 67,355,741 (GRCm39) missense probably benign 0.00
R4223:Xirp2 UTSW 2 67,346,837 (GRCm39) missense possibly damaging 0.66
R4257:Xirp2 UTSW 2 67,346,383 (GRCm39) missense probably benign 0.31
R4499:Xirp2 UTSW 2 67,343,782 (GRCm39) missense probably benign 0.08
R4577:Xirp2 UTSW 2 67,344,241 (GRCm39) missense probably damaging 0.99
R4739:Xirp2 UTSW 2 67,349,609 (GRCm39) missense probably damaging 0.99
R4758:Xirp2 UTSW 2 67,346,879 (GRCm39) missense probably damaging 0.98
R4834:Xirp2 UTSW 2 67,346,750 (GRCm39) missense probably benign 0.26
R4855:Xirp2 UTSW 2 67,341,408 (GRCm39) missense possibly damaging 0.96
R4923:Xirp2 UTSW 2 67,343,237 (GRCm39) missense probably benign
R4936:Xirp2 UTSW 2 67,340,163 (GRCm39) missense possibly damaging 0.85
R5032:Xirp2 UTSW 2 67,356,014 (GRCm39) missense possibly damaging 0.84
R5049:Xirp2 UTSW 2 67,347,478 (GRCm39) missense probably benign 0.03
R5077:Xirp2 UTSW 2 67,344,821 (GRCm39) missense probably benign
R5090:Xirp2 UTSW 2 67,355,814 (GRCm39) missense possibly damaging 0.83
R5107:Xirp2 UTSW 2 67,342,205 (GRCm39) missense probably damaging 1.00
R5107:Xirp2 UTSW 2 67,340,054 (GRCm39) missense probably damaging 0.99
R5187:Xirp2 UTSW 2 67,345,711 (GRCm39) missense probably benign 0.01
R5241:Xirp2 UTSW 2 67,312,704 (GRCm39) nonsense probably null
R5307:Xirp2 UTSW 2 67,341,506 (GRCm39) missense probably damaging 0.99
R5342:Xirp2 UTSW 2 67,343,805 (GRCm39) missense probably damaging 0.96
R5370:Xirp2 UTSW 2 67,342,496 (GRCm39) missense possibly damaging 0.72
R5375:Xirp2 UTSW 2 67,342,250 (GRCm39) missense probably damaging 0.99
R5407:Xirp2 UTSW 2 67,341,313 (GRCm39) missense probably benign 0.33
R5514:Xirp2 UTSW 2 67,335,465 (GRCm39) missense probably benign 0.03
R5531:Xirp2 UTSW 2 67,345,646 (GRCm39) missense probably benign 0.42
R5590:Xirp2 UTSW 2 67,344,379 (GRCm39) missense probably benign 0.23
R5646:Xirp2 UTSW 2 67,341,134 (GRCm39) missense probably damaging 0.99
R5649:Xirp2 UTSW 2 67,347,239 (GRCm39) missense probably benign 0.00
R5686:Xirp2 UTSW 2 67,312,642 (GRCm39) missense probably damaging 0.99
R5761:Xirp2 UTSW 2 67,341,311 (GRCm39) missense probably benign 0.00
R5777:Xirp2 UTSW 2 67,340,348 (GRCm39) missense possibly damaging 0.92
R5785:Xirp2 UTSW 2 67,340,006 (GRCm39) missense probably damaging 0.96
R5843:Xirp2 UTSW 2 67,307,129 (GRCm39) start gained probably benign
R5846:Xirp2 UTSW 2 67,339,587 (GRCm39) missense probably damaging 0.98
R5875:Xirp2 UTSW 2 67,335,424 (GRCm39) missense probably benign 0.00
R5896:Xirp2 UTSW 2 67,340,290 (GRCm39) missense possibly damaging 0.91
R5896:Xirp2 UTSW 2 67,339,042 (GRCm39) missense probably benign 0.32
R5901:Xirp2 UTSW 2 67,343,410 (GRCm39) missense possibly damaging 0.91
R5934:Xirp2 UTSW 2 67,355,148 (GRCm39) missense possibly damaging 0.92
R5950:Xirp2 UTSW 2 67,341,664 (GRCm39) missense possibly damaging 0.95
R5996:Xirp2 UTSW 2 67,341,994 (GRCm39) missense possibly damaging 0.91
R6013:Xirp2 UTSW 2 67,341,287 (GRCm39) missense possibly damaging 0.48
R6048:Xirp2 UTSW 2 67,338,587 (GRCm39) missense possibly damaging 0.96
R6111:Xirp2 UTSW 2 67,342,161 (GRCm39) missense possibly damaging 0.86
R6180:Xirp2 UTSW 2 67,335,921 (GRCm39) critical splice donor site probably null
R6342:Xirp2 UTSW 2 67,341,994 (GRCm39) missense possibly damaging 0.91
R6346:Xirp2 UTSW 2 67,346,425 (GRCm39) missense probably benign 0.00
R6603:Xirp2 UTSW 2 67,346,888 (GRCm39) missense probably benign
R6604:Xirp2 UTSW 2 67,340,189 (GRCm39) missense possibly damaging 0.86
R6669:Xirp2 UTSW 2 67,343,699 (GRCm39) missense possibly damaging 0.78
R6701:Xirp2 UTSW 2 67,346,569 (GRCm39) missense possibly damaging 0.94
R6726:Xirp2 UTSW 2 67,343,212 (GRCm39) missense possibly damaging 0.88
R6833:Xirp2 UTSW 2 67,340,294 (GRCm39) missense probably benign 0.12
R6897:Xirp2 UTSW 2 67,338,911 (GRCm39) missense probably damaging 1.00
R6933:Xirp2 UTSW 2 67,345,201 (GRCm39) missense probably benign 0.34
R7020:Xirp2 UTSW 2 67,355,913 (GRCm39) missense probably benign
R7042:Xirp2 UTSW 2 67,343,633 (GRCm39) missense probably benign 0.12
R7060:Xirp2 UTSW 2 67,345,952 (GRCm39) missense probably damaging 1.00
R7179:Xirp2 UTSW 2 67,340,177 (GRCm39) missense probably benign 0.00
R7229:Xirp2 UTSW 2 67,355,895 (GRCm39) missense probably damaging 0.99
R7253:Xirp2 UTSW 2 67,343,826 (GRCm39) missense probably benign
R7450:Xirp2 UTSW 2 67,340,159 (GRCm39) missense possibly damaging 0.86
R7476:Xirp2 UTSW 2 67,340,978 (GRCm39) missense probably benign 0.01
R7489:Xirp2 UTSW 2 67,355,904 (GRCm39) missense possibly damaging 0.83
R7513:Xirp2 UTSW 2 67,341,108 (GRCm39) missense possibly damaging 0.86
R7549:Xirp2 UTSW 2 67,339,241 (GRCm39) missense possibly damaging 0.91
R7563:Xirp2 UTSW 2 67,340,245 (GRCm39) missense probably damaging 0.99
R7567:Xirp2 UTSW 2 67,346,326 (GRCm39) missense probably benign 0.02
R7577:Xirp2 UTSW 2 67,345,309 (GRCm39) missense possibly damaging 0.65
R7597:Xirp2 UTSW 2 67,356,099 (GRCm39) missense possibly damaging 0.84
R7610:Xirp2 UTSW 2 67,356,306 (GRCm39) missense possibly damaging 0.92
R7613:Xirp2 UTSW 2 67,344,842 (GRCm39) missense probably benign 0.00
R7669:Xirp2 UTSW 2 67,342,521 (GRCm39) missense probably benign 0.00
R7670:Xirp2 UTSW 2 67,340,917 (GRCm39) missense possibly damaging 0.91
R7673:Xirp2 UTSW 2 67,347,431 (GRCm39) missense probably damaging 1.00
R7682:Xirp2 UTSW 2 67,339,193 (GRCm39) missense probably damaging 0.99
R7755:Xirp2 UTSW 2 67,345,526 (GRCm39) missense probably benign
R7805:Xirp2 UTSW 2 67,340,325 (GRCm39) missense probably benign 0.23
R7815:Xirp2 UTSW 2 67,339,756 (GRCm39) missense probably damaging 1.00
R7823:Xirp2 UTSW 2 67,342,118 (GRCm39) missense probably damaging 1.00
R7842:Xirp2 UTSW 2 67,355,289 (GRCm39) missense probably benign 0.00
R7863:Xirp2 UTSW 2 67,343,074 (GRCm39) missense probably benign 0.03
R7895:Xirp2 UTSW 2 67,339,841 (GRCm39) missense probably damaging 0.96
R7948:Xirp2 UTSW 2 67,349,658 (GRCm39) missense possibly damaging 0.95
R8083:Xirp2 UTSW 2 67,339,043 (GRCm39) missense possibly damaging 0.71
R8125:Xirp2 UTSW 2 67,342,379 (GRCm39) missense probably benign 0.25
R8154:Xirp2 UTSW 2 67,342,017 (GRCm39) missense possibly damaging 0.48
R8169:Xirp2 UTSW 2 67,343,543 (GRCm39) missense probably benign 0.00
R8213:Xirp2 UTSW 2 67,307,210 (GRCm39) missense probably damaging 0.96
R8215:Xirp2 UTSW 2 67,346,853 (GRCm39) missense probably benign 0.08
R8230:Xirp2 UTSW 2 67,346,009 (GRCm39) missense probably damaging 0.99
R8266:Xirp2 UTSW 2 67,338,918 (GRCm39) missense probably damaging 0.98
R8350:Xirp2 UTSW 2 67,355,713 (GRCm39) missense probably benign
R8432:Xirp2 UTSW 2 67,340,962 (GRCm39) missense probably benign
R8441:Xirp2 UTSW 2 67,343,159 (GRCm39) missense possibly damaging 0.85
R8677:Xirp2 UTSW 2 67,346,978 (GRCm39) missense probably damaging 0.98
R8773:Xirp2 UTSW 2 67,355,527 (GRCm39) missense probably benign
R8794:Xirp2 UTSW 2 67,341,557 (GRCm39) missense probably damaging 0.98
R8930:Xirp2 UTSW 2 67,312,707 (GRCm39) missense possibly damaging 0.72
R8932:Xirp2 UTSW 2 67,312,707 (GRCm39) missense possibly damaging 0.72
R8939:Xirp2 UTSW 2 67,346,488 (GRCm39) missense probably benign 0.04
R9263:Xirp2 UTSW 2 67,345,289 (GRCm39) missense possibly damaging 0.76
R9313:Xirp2 UTSW 2 67,347,322 (GRCm39) missense probably damaging 0.99
R9350:Xirp2 UTSW 2 67,349,653 (GRCm39) missense probably damaging 1.00
R9375:Xirp2 UTSW 2 67,342,118 (GRCm39) missense probably damaging 1.00
R9442:Xirp2 UTSW 2 67,342,235 (GRCm39) nonsense probably null
R9447:Xirp2 UTSW 2 67,338,950 (GRCm39) missense probably damaging 0.98
R9457:Xirp2 UTSW 2 67,345,976 (GRCm39) missense probably benign 0.03
R9507:Xirp2 UTSW 2 67,344,280 (GRCm39) missense possibly damaging 0.95
R9529:Xirp2 UTSW 2 67,355,540 (GRCm39) missense possibly damaging 0.93
R9569:Xirp2 UTSW 2 67,341,242 (GRCm39) missense probably damaging 1.00
R9607:Xirp2 UTSW 2 67,341,106 (GRCm39) missense possibly damaging 0.72
R9648:Xirp2 UTSW 2 67,346,599 (GRCm39) missense probably benign
R9651:Xirp2 UTSW 2 67,344,167 (GRCm39) missense possibly damaging 0.72
R9678:Xirp2 UTSW 2 67,339,788 (GRCm39) missense possibly damaging 0.91
R9691:Xirp2 UTSW 2 67,340,539 (GRCm39) missense possibly damaging 0.91
R9777:Xirp2 UTSW 2 67,347,379 (GRCm39) missense possibly damaging 0.85
RF035:Xirp2 UTSW 2 67,355,888 (GRCm39) utr 3 prime probably benign
RF040:Xirp2 UTSW 2 67,355,888 (GRCm39) utr 3 prime probably benign
X0063:Xirp2 UTSW 2 67,346,467 (GRCm39) missense probably benign 0.04
X0065:Xirp2 UTSW 2 67,345,462 (GRCm39) missense probably benign 0.34
Z1088:Xirp2 UTSW 2 67,343,665 (GRCm39) missense probably benign 0.03
Z1176:Xirp2 UTSW 2 67,344,923 (GRCm39) missense probably benign 0.17
Z1176:Xirp2 UTSW 2 67,341,737 (GRCm39) missense probably damaging 0.99
Z1176:Xirp2 UTSW 2 67,355,576 (GRCm39) missense probably damaging 1.00
Z1177:Xirp2 UTSW 2 67,355,715 (GRCm39) missense probably benign
Z1177:Xirp2 UTSW 2 67,340,537 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAACGTTTTCTGAATGGCCATG -3'
(R):5'- GACATCTTCATAGGTCGGTGG -3'

Sequencing Primer
(F):5'- GGGAATTTGAGAATGACCCAGTTTTC -3'
(R):5'- GGGCATGCTTGAAGTCAAAGCC -3'
Posted On 2019-06-26