Incidental Mutation 'R7284:Pla2g4d'
ID565848
Institutional Source Beutler Lab
Gene Symbol Pla2g4d
Ensembl Gene ENSMUSG00000070719
Gene Namephospholipase A2, group IVD
SynonymsPla2delta, 2610311B01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7284 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120265595-120289197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120284136 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 38 (L38Q)
Ref Sequence ENSEMBL: ENSMUSP00000092252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094665]
Predicted Effect probably damaging
Transcript: ENSMUST00000094665
AA Change: L38Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092252
Gene: ENSMUSG00000070719
AA Change: L38Q

DomainStartEndE-ValueType
C2 32 132 1.12e-18 SMART
PLAc 263 766 3.36e-11 SMART
Meta Mutation Damage Score 0.6378 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The phospholipase A2 enzyme family, including PLA2G4D, catalyze the hydrolysis of glycerophospholipids at the sn-2 position and then liberate free fatty acids and lysophospholipids (Chiba et al., 2004 [PubMed 14709560]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,734,583 H942Q probably benign Het
2900092C05Rik G T 7: 12,512,678 E34* probably null Het
4933421I07Rik C T 7: 42,447,980 R30H probably damaging Het
AB124611 C A 9: 21,539,104 Q158K probably benign Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc9 A T 6: 142,682,917 L367Q probably damaging Het
Aftph T C 11: 20,726,812 K266E probably benign Het
Akap9 T A 5: 3,956,246 D190E probably damaging Het
Angel1 G T 12: 86,720,524 D359E probably damaging Het
Ano6 T C 15: 95,948,303 I474T probably damaging Het
Atp2c1 A T 9: 105,520,809 probably null Het
Best1 T C 19: 9,986,373 probably null Het
Bhlha9 A G 11: 76,672,666 S40G probably benign Het
Cabin1 G A 10: 75,694,834 R178C Het
Ccnb1ip1 A G 14: 50,792,279 Y109H probably damaging Het
Col14a1 T C 15: 55,518,319 S1763P probably damaging Het
Dars T C 1: 128,372,267 T327A probably benign Het
Dhx8 T C 11: 101,754,822 Y889H probably damaging Het
Dlg4 T A 11: 70,042,082 Y523* probably null Het
Dnah10 A T 5: 124,832,598 D4484V probably benign Het
Dnah9 A T 11: 65,990,476 M2591K probably damaging Het
Dock2 T C 11: 34,230,672 E1715G probably benign Het
Dym A G 18: 75,119,171 Y336C possibly damaging Het
Ezh2 A G 6: 47,544,519 M439T probably benign Het
Folr1 T G 7: 101,859,470 N83H possibly damaging Het
Ganab T C 19: 8,912,540 L656P probably damaging Het
Gmnc T C 16: 26,960,792 H161R probably benign Het
Gria4 A G 9: 4,472,017 Y491H probably damaging Het
Heatr3 T A 8: 88,156,774 C412S possibly damaging Het
Hmgcr A C 13: 96,652,665 V716G probably damaging Het
Igsf9 A G 1: 172,496,912 D799G probably damaging Het
Ikbkb T C 8: 22,668,960 T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 R355* probably null Het
Kcna7 T A 7: 45,409,228 I313N probably damaging Het
Kirrel A C 3: 87,083,387 D709E probably benign Het
Klb T A 5: 65,383,478 S971R probably benign Het
Krtap4-13 A T 11: 99,809,412 C140* probably null Het
Lacc1 A T 14: 77,030,869 L334Q probably damaging Het
Map6d1 T A 16: 20,241,025 R97* probably null Het
Mgat5b T C 11: 116,944,920 S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myh9 G A 15: 77,787,596 R432C probably damaging Het
Ncf4 A G 15: 78,260,702 T236A probably benign Het
Neb T C 2: 52,258,792 D2581G probably damaging Het
Nid1 T A 13: 13,489,090 M778K probably benign Het
Npas2 A G 1: 39,324,467 D209G probably benign Het
Nploc4 C T 11: 120,416,370 V181I possibly damaging Het
Nrcam A T 12: 44,564,034 I506F probably damaging Het
Olfr197 A G 16: 59,185,968 *172Q probably null Het
Olfr692 T A 7: 105,368,545 M73K probably damaging Het
Olfr803 T C 10: 129,691,351 N230S probably benign Het
Pask T A 1: 93,320,669 Q970L probably benign Het
Pfkfb4 T C 9: 109,011,240 I308T possibly damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pom121l2 A G 13: 21,982,605 T349A probably damaging Het
Ppp1r13b A G 12: 111,834,966 I551T possibly damaging Het
Prps1l1 A G 12: 34,985,318 N144S possibly damaging Het
Prss56 A G 1: 87,185,401 N179S probably null Het
Prune2 T C 19: 17,119,886 L918P probably damaging Het
Ptprz1 C T 6: 23,000,098 T729I probably damaging Het
Rrp7a T C 15: 83,121,870 T60A probably damaging Het
Snx27 A G 3: 94,524,191 Y299H probably damaging Het
Spaca3 G T 11: 80,864,021 R96L possibly damaging Het
Stat1 A G 1: 52,148,922 N495S probably benign Het
Tas2r130 T C 6: 131,630,307 N175S probably benign Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tdrd12 C A 7: 35,480,136 probably null Het
Thbs1 A G 2: 118,119,356 N604S probably damaging Het
Togaram1 T C 12: 65,008,680 F1482L probably benign Het
Trhr2 A T 8: 122,360,375 S109T probably damaging Het
Trpc3 A T 3: 36,624,413 M841K probably damaging Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Xirp2 T A 2: 67,516,829 M3138K probably benign Het
Zdhhc4 G A 5: 143,321,891 T125I probably benign Het
Zfp239 T A 6: 117,871,755 C151* probably null Het
Zfp473 C T 7: 44,733,203 E569K not run Het
Zzef1 T A 11: 72,886,690 D1782E probably damaging Het
Other mutations in Pla2g4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pla2g4d APN 2 120281726 missense probably damaging 1.00
IGL01405:Pla2g4d APN 2 120266823 missense probably benign 0.01
IGL01642:Pla2g4d APN 2 120280636 missense probably damaging 1.00
IGL01657:Pla2g4d APN 2 120275287 missense possibly damaging 0.91
BB001:Pla2g4d UTSW 2 120289164 start gained probably benign
R0962:Pla2g4d UTSW 2 120280617 critical splice donor site probably null
R1564:Pla2g4d UTSW 2 120268903 missense possibly damaging 0.76
R1576:Pla2g4d UTSW 2 120284167 missense probably damaging 1.00
R1667:Pla2g4d UTSW 2 120270150 splice site probably benign
R1680:Pla2g4d UTSW 2 120277750 critical splice donor site probably null
R1712:Pla2g4d UTSW 2 120277490 missense possibly damaging 0.51
R2253:Pla2g4d UTSW 2 120271141 missense probably damaging 0.99
R2919:Pla2g4d UTSW 2 120281627 splice site probably benign
R3122:Pla2g4d UTSW 2 120278903 missense probably benign 0.03
R4420:Pla2g4d UTSW 2 120284163 missense probably benign
R4737:Pla2g4d UTSW 2 120266790 missense probably benign 0.00
R4829:Pla2g4d UTSW 2 120266743 missense probably damaging 1.00
R5032:Pla2g4d UTSW 2 120281695 nonsense probably null
R5530:Pla2g4d UTSW 2 120269555 missense probably benign 0.06
R5677:Pla2g4d UTSW 2 120278948 missense possibly damaging 0.87
R6087:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6088:Pla2g4d UTSW 2 120270006 missense probably damaging 1.00
R6150:Pla2g4d UTSW 2 120269564 missense probably damaging 1.00
R6930:Pla2g4d UTSW 2 120270633 missense probably damaging 1.00
R7240:Pla2g4d UTSW 2 120270349 missense probably damaging 1.00
R7339:Pla2g4d UTSW 2 120278978 missense probably benign
R7552:Pla2g4d UTSW 2 120284139 missense possibly damaging 0.56
R7607:Pla2g4d UTSW 2 120288976 missense probably benign
R7692:Pla2g4d UTSW 2 120279295 missense possibly damaging 0.84
R7860:Pla2g4d UTSW 2 120266730 missense probably benign 0.13
R7924:Pla2g4d UTSW 2 120289164 start gained probably benign
R7972:Pla2g4d UTSW 2 120278932 missense probably benign 0.04
R8373:Pla2g4d UTSW 2 120277499 missense probably null 1.00
X0026:Pla2g4d UTSW 2 120277471 missense probably damaging 0.99
X0028:Pla2g4d UTSW 2 120281726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGACAAAGTCAAGGGGAC -3'
(R):5'- ACCCCAAGGCTATCTGTCTC -3'

Sequencing Primer
(F):5'- CAGAAGAGAGTGGATTCTATACATCC -3'
(R):5'- TCTAAGGTGTTCCCCCAAAGG -3'
Posted On2019-06-26