Mutagenetix > Incidental Mutations

Incidental Mutation 'R7284:Kirrel'

565851

Institutional Source

Beutler Lab

Gene Symbol

Kirrel

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

Kirrel1, 6720469N11Rik, Neph1

MMRRC Submission

Accession Numbers

Genbank: NM_130867; MGI: 1891396

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87078593-87174747 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 87083387 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 709 (D709E)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

Predicted Effect

probably benign
Transcript: ENSMUST00000041732

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107618
AA Change: D709E

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: D709E

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159976
AA Change: D709E

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: D709E

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,734,583	H942Q	probably benign	Het
2900092C05Rik	G	T	7: 12,512,678	E34*	probably null	Het
4933421I07Rik	C	T	7: 42,447,980	R30H	probably damaging	Het
AB124611	C	A	9: 21,539,104	Q158K	probably benign	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abcc9	A	T	6: 142,682,917	L367Q	probably damaging	Het
Aftph	T	C	11: 20,726,812	K266E	probably benign	Het
Akap9	T	A	5: 3,956,246	D190E	probably damaging	Het
Angel1	G	T	12: 86,720,524	D359E	probably damaging	Het
Ano6	T	C	15: 95,948,303	I474T	probably damaging	Het
Atp2c1	A	T	9: 105,520,809		probably null	Het
Best1	T	C	19: 9,986,373		probably null	Het
Bhlha9	A	G	11: 76,672,666	S40G	probably benign	Het
Cabin1	G	A	10: 75,694,834	R178C		Het
Ccnb1ip1	A	G	14: 50,792,279	Y109H	probably damaging	Het
Col14a1	T	C	15: 55,518,319	S1763P	probably damaging	Het
Dars	T	C	1: 128,372,267	T327A	probably benign	Het
Dhx8	T	C	11: 101,754,822	Y889H	probably damaging	Het
Dlg4	T	A	11: 70,042,082	Y523*	probably null	Het
Dnah10	A	T	5: 124,832,598	D4484V	probably benign	Het
Dnah9	A	T	11: 65,990,476	M2591K	probably damaging	Het
Dock2	T	C	11: 34,230,672	E1715G	probably benign	Het
Dym	A	G	18: 75,119,171	Y336C	possibly damaging	Het
Ezh2	A	G	6: 47,544,519	M439T	probably benign	Het
Folr1	T	G	7: 101,859,470	N83H	possibly damaging	Het
Ganab	T	C	19: 8,912,540	L656P	probably damaging	Het
Gmnc	T	C	16: 26,960,792	H161R	probably benign	Het
Gria4	A	G	9: 4,472,017	Y491H	probably damaging	Het
Heatr3	T	A	8: 88,156,774	C412S	possibly damaging	Het
Hmgcr	A	C	13: 96,652,665	V716G	probably damaging	Het
Igsf9	A	G	1: 172,496,912	D799G	probably damaging	Het
Ikbkb	T	C	8: 22,668,960	T501A	probably benign	Het
Kbtbd3	C	T	9: 4,330,690	R355*	probably null	Het
Kcna7	T	A	7: 45,409,228	I313N	probably damaging	Het
Klb	T	A	5: 65,383,478	S971R	probably benign	Het
Krtap4-13	A	T	11: 99,809,412	C140*	probably null	Het
Lacc1	A	T	14: 77,030,869	L334Q	probably damaging	Het
Map6d1	T	A	16: 20,241,025	R97*	probably null	Het
Mgat5b	T	C	11: 116,944,920	S129P	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Myh9	G	A	15: 77,787,596	R432C	probably damaging	Het
Ncf4	A	G	15: 78,260,702	T236A	probably benign	Het
Neb	T	C	2: 52,258,792	D2581G	probably damaging	Het
Nid1	T	A	13: 13,489,090	M778K	probably benign	Het
Npas2	A	G	1: 39,324,467	D209G	probably benign	Het
Nploc4	C	T	11: 120,416,370	V181I	possibly damaging	Het
Nrcam	A	T	12: 44,564,034	I506F	probably damaging	Het
Olfr197	A	G	16: 59,185,968	*172Q	probably null	Het
Olfr692	T	A	7: 105,368,545	M73K	probably damaging	Het
Olfr803	T	C	10: 129,691,351	N230S	probably benign	Het
Pask	T	A	1: 93,320,669	Q970L	probably benign	Het
Pfkfb4	T	C	9: 109,011,240	I308T	possibly damaging	Het
Pla2g4d	A	T	2: 120,284,136	L38Q	probably damaging	Het
Pld1	A	G	3: 28,131,733	T1036A	possibly damaging	Het
Pom121l2	A	G	13: 21,982,605	T349A	probably damaging	Het
Ppp1r13b	A	G	12: 111,834,966	I551T	possibly damaging	Het
Prps1l1	A	G	12: 34,985,318	N144S	possibly damaging	Het
Prss56	A	G	1: 87,185,401	N179S	probably null	Het
Prune2	T	C	19: 17,119,886	L918P	probably damaging	Het
Ptprz1	C	T	6: 23,000,098	T729I	probably damaging	Het
Rrp7a	T	C	15: 83,121,870	T60A	probably damaging	Het
Snx27	A	G	3: 94,524,191	Y299H	probably damaging	Het
Spaca3	G	T	11: 80,864,021	R96L	possibly damaging	Het
Stat1	A	G	1: 52,148,922	N495S	probably benign	Het
Tas2r130	T	C	6: 131,630,307	N175S	probably benign	Het
Tcaf2	A	G	6: 42,629,538	L494P	probably damaging	Het
Tdrd12	C	A	7: 35,480,136		probably null	Het
Thbs1	A	G	2: 118,119,356	N604S	probably damaging	Het
Togaram1	T	C	12: 65,008,680	F1482L	probably benign	Het
Trhr2	A	T	8: 122,360,375	S109T	probably damaging	Het
Trpc3	A	T	3: 36,624,413	M841K	probably damaging	Het
Tubgcp5	C	T	7: 55,823,567	R798C	probably benign	Het
Xirp2	T	A	2: 67,516,829	M3138K	probably benign	Het
Zdhhc4	G	A	5: 143,321,891	T125I	probably benign	Het
Zfp239	T	A	6: 117,871,755	C151*	probably null	Het
Zfp473	C	T	7: 44,733,203	E569K	not run	Het
Zzef1	T	A	11: 72,886,690	D1782E	probably damaging	Het

Other mutations in Kirrel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel	APN	3	87089875	missense	probably benign	0.22
IGL01865:Kirrel	APN	3	87086424	missense	probably damaging	1.00
IGL01875:Kirrel	APN	3	87095730	missense	probably damaging	1.00
IGL02337:Kirrel	APN	3	87089212	missense	possibly damaging	0.64
IGL02724:Kirrel	APN	3	87090473	nonsense	probably null
IGL02825:Kirrel	APN	3	87089288	splice site	probably benign
IGL02826:Kirrel	APN	3	87088485	missense	probably damaging	1.00
IGL03102:Kirrel	APN	3	87083500	missense	probably damaging	0.98
D4043:Kirrel	UTSW	3	87083203	missense	probably benign	0.02
R0360:Kirrel	UTSW	3	87089799	missense	probably damaging	1.00
R0364:Kirrel	UTSW	3	87089799	missense	probably damaging	1.00
R0421:Kirrel	UTSW	3	87083607	missense	probably damaging	0.99
R0503:Kirrel	UTSW	3	87097802	missense	probably benign	0.20
R1112:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1116:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1144:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1147:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1190:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1226:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1501:Kirrel	UTSW	3	87090472	missense	probably benign	0.02
R1538:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1546:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1628:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1630:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1631:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1664:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1671:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1695:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1769:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1807:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1808:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1840:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1876:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R1995:Kirrel	UTSW	3	87095786	missense	possibly damaging	0.88
R2014:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2086:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2108:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2354:Kirrel	UTSW	3	87088485	missense	probably damaging	0.98
R2407:Kirrel	UTSW	3	87084843	missense	probably benign	0.03
R2904:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2905:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2958:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2959:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2960:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R2961:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3026:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3028:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3034:Kirrel	UTSW	3	87083439	missense	possibly damaging	0.56
R3149:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3195:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3196:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3499:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3699:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3720:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3721:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3788:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3793:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3876:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3877:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3901:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3910:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3911:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3912:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3913:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3930:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R3931:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4022:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4067:Kirrel	UTSW	3	87088467	nonsense	probably null
R4077:Kirrel	UTSW	3	87085080	critical splice donor site	probably null
R4198:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4328:Kirrel	UTSW	3	87084774	intron	probably benign
R4355:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4363:Kirrel	UTSW	3	87090485	nonsense	probably null
R4378:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4386:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4460:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4468:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4469:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4650:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4652:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4734:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4748:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R4749:Kirrel	UTSW	3	87089151	missense	probably null	0.46
R5304:Kirrel	UTSW	3	87089595	missense	probably benign	0.02
R5534:Kirrel	UTSW	3	87090518	missense	probably damaging	1.00
R5604:Kirrel	UTSW	3	87089155	missense	possibly damaging	0.69
R7199:Kirrel	UTSW	3	87083388	missense	probably benign	0.02
R7221:Kirrel	UTSW	3	87086397	nonsense	probably null
R7332:Kirrel	UTSW	3	87088398	missense	probably benign	0.14
R7369:Kirrel	UTSW	3	87141084	missense	probably benign	0.20
R7371:Kirrel	UTSW	3	87088422	missense	probably benign	0.44
R7508:Kirrel	UTSW	3	87083439	missense	possibly damaging	0.56
R7566:Kirrel	UTSW	3	87088484	missense	probably damaging	1.00
R7567:Kirrel	UTSW	3	87095681	missense	probably damaging	0.99
R7621:Kirrel	UTSW	3	87088221	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CCAGCCTCTACACATGAGTCTG -3'
(R):5'- TGTATGCTGACTACCGTGCC -3'

Sequencing Primer
(F):5'- AATCGCTGGCCATAGTCTGAG -3'
(R):5'- TGACTACCGTGCCCCTGG -3'

Posted On

2019-06-26